HUGE

Gene/Protein Characteristic Table for KIAA0339

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB002337
Description :	Histone-lysine N-methyltransferase, H3 lysine-4 specific SET1.
HUGO Gene Name :	SET domain containing 1A (SETD1A)
Clone Name :	hg01304 [Vector Info]
Flexi ORF Clone :	pF1KA0339
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6446 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES YES

Integrity of 3' end

Length of 3'UTR 637 bp

Genome contig ID gi51511732f_30776116
PolyA signal sequence
(ATTAAA,-17)
+----*----+----*----+----*----+----
CACATTTTTATAATTGTGATTAAACTTTATTGTAC
Flanking genome sequence
(127368 - 127417)
----+----*----+----*----+----*----+----*----+----*
AAAAGTGTTTGGTCGGTGTATTTGGGCAGGAGCGAGGGGTTGGGGGTAGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 30876116 30903482 19 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1709 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O15047	100.0	Histone-lysine ...	Homo sapiens
XP_523492	99.6	SET domain cont...	Pan troglodytes
XP_001915080	93.4	SET domain cont...	Equus caballus
XP_001251265	92.6	similar to SET ...	Bos taurus
XP_001364653	79.5	similar to SET ...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028999	1.7e-24	40.5	KIAA1076
AB002302	4.9e-06	26.4	KIAA0304

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000504 112 169 PF00076 RNA recognition motif

IPR001214 1564 1693 PF00856 SET

HMMSmart IPR000504 97 170 SM00360 RNA recognition motif

IPR001214 1570 1693 SM00317 SET

IPR003616 1693 1709 SM00508 Post-SET zinc-binding region

ProfileScan IPR000504 86 174 PS50102 RNA recognition motif

IPR001214 1569 1691 PS50280 SET

IPR003616 1693 1709 PS50868 Post-SET zinc-binding region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	112	169	PF00076	RNA recognition motif
IPR001214	1564	1693	PF00856	SET
HMMSmart	IPR000504	97	170	SM00360	RNA recognition motif
IPR001214	1570	1693	SM00317	SET
IPR003616	1693	1709	SM00508	Post-SET zinc-binding region
ProfileScan	IPR000504	86	174	PS50102	RNA recognition motif
IPR001214	1569	1691	PS50280	SET
IPR003616	1693	1709	PS50868	Post-SET zinc-binding region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TCAGAATTCCTCGGGTCCCTC

Primer_r
: TGGCCCAAGTGAGAGAATAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCAGAATTCCTCGGGTCCCTC
Primer_r	: TGGCCCAAGTGAGAGAATAGC
PCR product length	: 119 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	YES

Length of 3'UTR	637 bp
Genome contig ID	gi51511732f_30776116
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- CACATTTTTATAATTGTGATTAAACTTTATTGTAC
Flanking genome sequence (127368 - 127417)	----+--------+--------+--------+--------+----* AAAAGTGTTTGGTCGGTGTATTTGGGCAGGAGCGAGGGGTTGGGGGTAGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	30876116	30903482	19	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0339

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information