| HUGE |
Gene/Protein Characteristic Table for KIAA0339 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | |
|---|---|
| Accession No. : | AB002337 |
| Description : | Histone-lysine N-methyltransferase, H3 lysine-4 specific SET1. |
| HUGO Gene Name : | SET domain containing 1A (SETD1A) |
| Clone Name : | hg01304 [Vector Info] |
| Flexi ORF Clone : | pF1KA0339
![]() |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6446 bp
|
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
| cloned DNA seq. | Warning for N-terminal truncation: NO | NO | Warning for coding interruption: YES | YES | |
Length of 3'UTR 637 bp Genome contig ID gi51511732f_30776116 PolyA signal sequence
(ATTAAA,-17) +----*----+----*----+----*----+----
CACATTTTTATAATTGTGATTAAACTTTATTGTACFlanking genome sequence
(127368 - 127417) ----+----*----+----*----+----*----+----*----+----*
AAAAGTGTTTGGTCGGTGTATTTGGGCAGGAGCGAGGGGTTGGGGGTAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 f 30876116 30903482 19 99.9 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1709 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : TCAGAATTCCTCGGGTCCCTC | |
| : TGGCCCAAGTGAGAGAATAGC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 16 |
| : GeneBridge 4 | |
| : TCAGAATTCCTCGGGTCCCTC | |
| : TGGCCCAAGTGAGAGAATAGC | |
| : 119 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |