HUGE

Gene/Protein Characteristic Table for KIAA0304

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07348
Accession No. :	AB002302
Description :	WW domain-binding protein 7.
HUGO Gene Name :
Clone Name :	af07172 [Vector Info]
Source :	Human brain (amygdala)
Note :	We replaced hg00016, former representative clones for KIAA0304 with af07172. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 7568 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 320 bp

Genome contig ID gi42406306f_40802990
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GGAACCCCCCCACAATAAAGTCTGTCAATGTTTGG
Flanking genome sequence
(118630 - 118679)
----+----*----+----*----+----*----+----*----+----*
AGAGGTGGTCTTCCCATTTGTAGGCTGTGGGGGCAGGTAGGAACCCCACT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 40902990 40921618 35 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 2415 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAD56420	100.0	MLL2 protein [H...	Homo sapiens
Q9UMN6	100.0	Histone-lysine ...	Homo sapiens
XP_512597	99.4	myeloid/lymphoi...	Pan troglodytes
XP_341830	90.0	similar to WW d...	Rattus norvegicus
EDM07733	91.3	rCG63528 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028999	1.4e-07	29.3	KIAA1076
AB002337	3.3e-06	26.4	KIAA0339
AB051468	2.8e-05	27.0	KIAA1681

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002857 659 705 PF02008 Zinc finger

IPR001965 903 952 PF00628 Zinc finger

IPR001965 953 1003 PF00628 Zinc finger

IPR001965 1037 1096 PF00628 Zinc finger

IPR003888 1432 1482 PF05964 FY-rich

IPR003889 2111 2194 PF05965 FY-rich

IPR001214 2269 2397 PF00856 SET

HMMSmart IPR001965 903 950 SM00249 Zinc finger

IPR001965 951 1001 SM00249 Zinc finger

IPR001965 1037 1094 SM00249 Zinc finger

IPR001965 1340 1386 SM00249 Zinc finger

IPR003888 1439 1482 SM00541 FY-rich

IPR003889 2113 2198 SM00542 FY-rich

IPR001214 2275 2397 SM00317 SET

IPR003616 2399 2415 SM00508 Post-SET zinc-binding region

ProfileScan IPR002857 659 706 PS51058 Zinc finger

IPR001965 901 952 PS50016 Zinc finger

IPR001965 949 1003 PS50016 Zinc finger

IPR001965 1035 1096 PS50016 Zinc finger

IPR001214 2274 2395 PS50280 SET

IPR003616 2399 2415 PS50868 Post-SET zinc-binding region

ScanRegExp IPR001965 904 971 PS01359 Zinc finger

IPR001965 1025 1093 PS01359 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002857	659	705	PF02008	Zinc finger
IPR001965	903	952	PF00628	Zinc finger
IPR001965	953	1003	PF00628	Zinc finger
IPR001965	1037	1096	PF00628	Zinc finger
IPR003888	1432	1482	PF05964	FY-rich
IPR003889	2111	2194	PF05965	FY-rich
IPR001214	2269	2397	PF00856	SET
HMMSmart	IPR001965	903	950	SM00249	Zinc finger
IPR001965	951	1001	SM00249	Zinc finger
IPR001965	1037	1094	SM00249	Zinc finger
IPR001965	1340	1386	SM00249	Zinc finger
IPR003888	1439	1482	SM00541	FY-rich
IPR003889	2113	2198	SM00542	FY-rich
IPR001214	2275	2397	SM00317	SET
IPR003616	2399	2415	SM00508	Post-SET zinc-binding region
ProfileScan	IPR002857	659	706	PS51058	Zinc finger
IPR001965	901	952	PS50016	Zinc finger
IPR001965	949	1003	PS50016	Zinc finger
IPR001965	1035	1096	PS50016	Zinc finger
IPR001214	2274	2395	PS50280	SET
IPR003616	2399	2415	PS50868	Post-SET zinc-binding region
ScanRegExp	IPR001965	904	971	PS01359	Zinc finger
IPR001965	1025	1093	PS01359	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: ACTTTATTGTGGGGGGGTTCC

Primer_r
: ATGTTCAGGGTGGATGTGGGC

PCR conditions
: 95 °C15 sec68 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACTTTATTGTGGGGGGGTTCC
Primer_r	: ATGTTCAGGGTGGATGTGGGC
PCR product length	: 196 bp
PCR conditions	: 95 °C15 sec68 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	320 bp
Genome contig ID	gi42406306f_40802990
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GGAACCCCCCCACAATAAAGTCTGTCAATGTTTGG
Flanking genome sequence (118630 - 118679)	----+--------+--------+--------+--------+----* AGAGGTGGTCTTCCCATTTGTAGGCTGTGGGGGCAGGTAGGAACCCCACT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	40902990	40921618	35	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0304

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information