HUGE

Gene/Protein Characteristic Table for KIAA0207

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00458
Accession No. :	D86962
Description :	Growth factor receptor-bound protein 10.
HUGO Gene Name :
Clone Name :	ha02795 [Vector Info]
Flexi ORF Clone :	pF1KSDA0207
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5431 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2883 bp

Genome contig ID gi89161213r_50525260
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TGTAATTAGAAATAAACATTAATACAGTGTTCTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTTCTATTGCTGGTGATATCTGTTTCTAATTTTAAAACACTGGCCAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 50625260 50828160 18 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 605 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09655	100.0	growth factor r...	synthetic construct
EAL23897	99.8	growth factor r...	Homo sapiens
XP_001154856	99.5	similar to grow...	Pan troglodytes
Q13322	99.7	Growth factor r...	Homo sapiens
XP_001154916	99.3	growth factor r...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051468	5.9e-18	28.0	KIAA1681

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000980 504 600 PD000093 SH2 motif

FPrintScan IPR000980 504 518 PR00401 SH2 motif

IPR000980 525 535 PR00401 SH2 motif

IPR000980 574 588 PR00401 SH2 motif

HMMPfam IPR000159 177 261 PF00788 Ras-association

IPR001849 302 410 PF00169 Pleckstrin-like

IPR015042 434 483 PF08947 BPS (Between PH and SH2)

IPR000980 504 585 PF00017 SH2 motif

HMMSmart IPR000159 177 261 SM00314 Ras-association

IPR001849 302 412 SM00233 Pleckstrin-like

IPR000980 502 591 SM00252 SH2 motif

ProfileScan IPR000159 177 261 PS50200 Ras-association

IPR001849 301 410 PS50003 Pleckstrin-like

IPR000980 504 600 PS50001 SH2 motif

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000980	504	600	PD000093	SH2 motif
FPrintScan	IPR000980	504	518	PR00401	SH2 motif
IPR000980	525	535	PR00401	SH2 motif
IPR000980	574	588	PR00401	SH2 motif
HMMPfam	IPR000159	177	261	PF00788	Ras-association
IPR001849	302	410	PF00169	Pleckstrin-like
IPR015042	434	483	PF08947	BPS (Between PH and SH2)
IPR000980	504	585	PF00017	SH2 motif
HMMSmart	IPR000159	177	261	SM00314	Ras-association
IPR001849	302	412	SM00233	Pleckstrin-like
IPR000980	502	591	SM00252	SH2 motif
ProfileScan	IPR000159	177	261	PS50200	Ras-association
IPR001849	301	410	PS50003	Pleckstrin-like
IPR000980	504	600	PS50001	SH2 motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TGCCAGACACTCCCAAATCCC
Primer_r	: AATCCGCGAGCCCTCAACTTG
PCR product length	: 120 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2883 bp
Genome contig ID	gi89161213r_50525260
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TGTAATTAGAAATAAACATTAATACAGTGTTCTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTCTATTGCTGGTGATATCTGTTTCTAATTTTAAAACACTGGCCAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	50625260	50828160	18	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0207

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information