HUGE

Gene/Protein Characteristic Table for KIAA0764

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00629
Accession No. :	AB018307
Description :	STAGA complex 65 subunit gamma.
HUGO Gene Name :	suppressor of Ty 7 (S. cerevisiae)-like (SUPT7L)
Clone Name :	hk04750 [Vector Info]
Flexi ORF Clone :	pF1KSDA0764
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4261 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2673 bp

Genome contig ID gi89161199r_27627183
PolyA signal sequence
(ATTAAA,-30)
+----*----+----*----+----*----+----
TTAAAATTAAAAAGTCTTTATCCAAGTCACCAATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACAGGATTCTGATTCATTAATCATGTCTTGCCCACTTTTTTCAACAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 27727183 27739953 6 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 419 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O94864	6.4e-163	100.0	STAGA complex 6...	Homo sapiens
XP_001098585	1.5e-162	99.8	SPTF-associated...	Macaca mulatta
AAG47636	2.2e-161	99.5	antigen ART1/P1...	Homo sapiens
XP_001098896	5e-161	99.3	SPTF-associated...	Macaca mulatta
XP_001502177	5.8e-161	98.3	similar to STAG...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006565 156 235 PF07524 Bromodomain transcription factor

HMMSmart IPR006565 156 235 SM00576 Bromodomain transcription factor

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006565	156	235	PF07524	Bromodomain transcription factor
HMMSmart	IPR006565	156	235	SM00576	Bromodomain transcription factor

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTATGAAATGTGCCTCTGACC

Primer_r
: TTCCCACGTGCACATACTGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2673 bp
Genome contig ID	gi89161199r_27627183
PolyA signal sequence (ATTAAA,-30)	+--------+--------+----*----+---- TTAAAATTAAAAAGTCTTTATCCAAGTCACCAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACAGGATTCTGATTCATTAATCATGTCTTGCCCACTTTTTTCAACAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	27727183	27739953	6	99.2	Perfect prediction

Primer_f	: GTATGAAATGTGCCTCTGACC
Primer_r	: TTCCCACGTGCACATACTGAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0764

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information