HUGE |
Gene/Protein Characteristic Table for KIAA0770 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00631 |
---|---|
Accession No. : | AB018313 |
Description : | Vam6/Vps39-like protein. |
HUGO Gene Name : | vacuolar protein sorting 39 homolog (S. cerevisiae) (VPS39) |
Clone Name : | hk05040s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0770
![]() |
Source : | Human adult brain |
Note : | We replaced hk05040, former representative clones for KIAA0770 with hk05040s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4793 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2041 bp Genome contig ID gi51511731r_40138203 PolyA signal sequence
(AATAAA,-11) +----*----+----*----+----*----+----
ATCACTGCTCCTTATAATAAACCTAATAAAGCAAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAACCAAGCCTATCTGGGTCTCTTATTTCTCCCTCCCGTGGAGTTTGATG
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 r 40238203 40287767 25 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 913 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TTGACCTGCCATGTGTGCCCT | |
: CATCTCCAGCCTTCTCCATAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 15 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |