HUGE

Gene/Protein Characteristic Table for KIAA0771

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06455
Accession No. :	AB018314
Description :	Apoptosis-stimulating of p53 protein 1.
HUGO Gene Name :	protein phosphatase 1, regulatory (inhibitor) subunit 13B (PPP1R13B)
Clone Name :	hk05113 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4250 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Features of the protein sequence	Description

Length: 948 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW81847	100.0	protein phospha...	Homo sapiens
Q96KQ4	100.0	Apoptosis-stimu...	Homo sapiens
XP_510191	99.4	protein phospha...	Pan troglodytes
XP_001088783	98.4	similar to prot...	Macaca mulatta
XP_001492487	92.7	protein phospha...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 881 932 PD000066 Src homology-3

FPrintScan IPR002110 779 791 PR01415 Ankyrin

IPR002110 791 803 PR01415 Ankyrin

IPR001452 880 890 PR00452 Src homology-3

IPR001452 894 909 PR00452 Src homology-3

IPR001452 925 937 PR00452 Src homology-3

HMMPfam IPR002110 778 810 PF00023 Ankyrin

IPR002110 811 843 PF00023 Ankyrin

IPR001452 880 937 PF00018 Src homology-3

HMMSmart IPR002110 778 807 SM00248 Ankyrin

IPR002110 811 840 SM00248 Ankyrin

IPR001452 880 938 SM00326 Src homology-3

ProfileScan IPR002110 745 843 PS50297 Ankyrin

IPR002110 778 810 PS50088 Ankyrin

IPR002110 811 843 PS50088 Ankyrin

IPR001452 877 939 PS50002 Src homology-3

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	881	932	PD000066	Src homology-3
FPrintScan	IPR002110	779	791	PR01415	Ankyrin
IPR002110	791	803	PR01415	Ankyrin
IPR001452	880	890	PR00452	Src homology-3
IPR001452	894	909	PR00452	Src homology-3
IPR001452	925	937	PR00452	Src homology-3
HMMPfam	IPR002110	778	810	PF00023	Ankyrin
IPR002110	811	843	PF00023	Ankyrin
IPR001452	880	937	PF00018	Src homology-3
HMMSmart	IPR002110	778	807	SM00248	Ankyrin
IPR002110	811	840	SM00248	Ankyrin
IPR001452	880	938	SM00326	Src homology-3
ProfileScan	IPR002110	745	843	PS50297	Ankyrin
IPR002110	778	810	PS50088	Ankyrin
IPR002110	811	843	PS50088	Ankyrin
IPR001452	877	939	PS50002	Src homology-3

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCACTGTAGCCCATCACCTTG

Primer_r
: TTACACAGCGTCAGCAGCGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Primer_f	: GCACTGTAGCCCATCACCTTG
Primer_r	: TTACACAGCGTCAGCAGCGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0771

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information