HUGE

Gene/Protein Characteristic Table for KIAA0774

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00129
Accession No. :	AB018317
Description :
HUGO Gene Name :
Clone Name :	bh00283 [Vector Info]
Flexi ORF Clone :	pF1KA0774
Source :	Human adult brain
Note :	We replaced hk05183, former representative clones for KIAA0774 with bh00283. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 4734 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 536 bp

Genome contig ID gi51511729f_28396748
PolyA signal sequence
(AATAGA,-12)
+----*----+----*----+----*----+----
TTCCCAGGAATATTTCTACCCAAAATAGAAAAAGG
Flanking genome sequence
(579133 - 579182)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAGATACAGAGAAGAAGCGCCTTTCAACTCACCACCAAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 f 28496748 28975879 14 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1381 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_001028774	0	99.9	hypothetical pr...	Homo sapiens
XP_001117981	0	91.6	hypothetical pr...	Macaca mulatta
XP_543149	0	77.4	similar to ZK18...	Canis lupus fam...
CAH90662	3.7e-87	98.8	hypothetical pr...	Pongo abelii
AAH55016	2.1e-81	89.7	C130038G02Rik p...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033114	3.8e-17	32.0	KIAA1288

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACCCAGATGACGCCACTACAC

Primer_r
: GCAGTCTTACACGGGGATCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	536 bp
Genome contig ID	gi51511729f_28396748
PolyA signal sequence (AATAGA,-12)	+--------+--------+----*----+---- TTCCCAGGAATATTTCTACCCAAAATAGAAAAAGG
Flanking genome sequence (579133 - 579182)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGATACAGAGAAGAAGCGCCTTTCAACTCACCACCAAGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	f	28496748	28975879	14	100.0	Perfect prediction

Primer_f	: ACCCAGATGACGCCACTACAC
Primer_r	: GCAGTCTTACACGGGGATCAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0774

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information