HUGE

Gene/Protein Characteristic Table for KIAA1288

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB033114
Description :	mitochondrial tumor suppressor 1 isoform 5.
HUGO Gene Name :	mitochondrial tumor suppressor 1 (MTUS1)
Clone Name :	hh13551 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5857 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 2118 bp

Genome contig ID gi51511724r_17445593
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TTTACTCTGATCAAATAAATAATGCTGGAATACTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGAATTGCATCCTCTGACCTACTTCATTCTTCAAATTCTTCATTTTTAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 17545593 17657522 14 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1245 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULD2	100.0	Mitochondrial t...	Homo sapiens
EAW63805	99.9	mitochondrial t...	Homo sapiens
EAW63809	99.6	mitochondrial t...	Homo sapiens
EAW63806	99.9	mitochondrial t...	Homo sapiens
Q5R9I1	96.9	Mitochondrial t...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018317	3.7e-19	32.2	KIAA0774

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACCTTCCATGTTTGCTTCTGA

Primer_r
: ACAACACAAGATTTACCATGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	2118 bp
Genome contig ID	gi51511724r_17445593
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTTACTCTGATCAAATAAATAATGCTGGAATACTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGAATTGCATCCTCTGACCTACTTCATTCTTCAAATTCTTCATTTTTAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	17545593	17657522	14	99.3	Perfect prediction

Primer_f	: ACCTTCCATGTTTGCTTCTGA
Primer_r	: ACAACACAAGATTTACCATGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1288

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information