HUGE |
Gene/Protein Characteristic Table for KIAA0789 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00639 |
---|---|
Accession No. : | AB018332 |
Description : | WSC domain containing 2. |
HUGO Gene Name : | WSC domain containing 2 (WSCD2) |
Clone Name : | pj01253 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0789
![]() |
Source : | Human brain (hippocampus) |
Note : | We replaced hk05559, former representative clones for KIAA0789 with pj01253. (2001/5/29) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4217 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1775 bp Genome contig ID gi89161190f_106947641 PolyA signal sequence
(ATTAAA,-28) +----*----+----*----+----*----+----
CACCATCATTAAATGCGAGTTTTGTTGATGATTCTFlanking genome sequence
(220386 - 220435) ----+----*----+----*----+----*----+----*----+----*
ACCATGTGGTAGAGTGTTGTGTAAGACAGGTTCACAAATGGGATGTTTTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 f 107047641 107168025 9 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 620 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GAAGTGCTGGTTAGTCTGTGC | |
: AAGCCATTCATGATCACAGGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 12 |
: GeneBridge 4 | |
: GAAGTGCTGGTTAGTCTGTGC | |
: AAGCCATTCATGATCACAGGG | |
: 92 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |