HUGE |
Gene/Protein Characteristic Table for KIAA0800 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01675 |
---|---|
Accession No. : | AB018343 |
Description : | Protein VPRBP. |
HUGO Gene Name : | Vpr (HIV-1) binding protein (VPRBP) |
Clone Name : | hg03850s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0800
![]() |
Source : | Human adult brain |
Note : | We replaced hg03850, former representative clones for KIAA0800 with hg03850s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5984 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1292 bp Genome contig ID gi89161205r_51308382 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
AAAACAGGCAAATAAATAAACATGCTTAACATGTCFlanking genome sequence
(99956 - 99907) ----+----*----+----*----+----*----+----*----+----*
TTTGTGTTGCTGTTTTGTTATGAACGTGCTTGCTCTCTTGCGAGGCACCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 51408338 51509041 25 100.0 Internal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1521 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AACAACATACCAAGGCAGCTC | |
: AGTCAGTTGGGTACAGCAGGA | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: GeneBridge 4 | |
: AACAACATACCAAGGCAGCTC | |
: AGTCAGTTGGGTACAGCAGGA | |
: 160 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |