HUGE |
Gene/Protein Characteristic Table for KIAA0804 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | AB018347 |
Description : | Vacuolar protein sorting-associated protein 8 homolog. |
HUGO Gene Name : | |
Clone Name : | hk01186 [Vector Info] |
Flexi ORF Clone : | pF1KA0804 |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4217 bp
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
cloned DNA seq. | Warning for N-terminal truncation: YES | YES | Warning for coding interruption: YES | NO | |
Length of 3'UTR 579 bp Genome contig ID gi89161205f_185950416 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
CCCTTTCTAACAATAAATGCTCCGTGTTTAAGTTCFlanking genome sequence
(302672 - 302721) ----+----*----+----*----+----*----+----*----+----*
TGCAGGTCTCCTGGCTGGCTGGCTCTCAGTCTGTCAAGTCATGGAGGACA
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 f 186049662 186253086 40 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1211 aa
This protein sequence is predicted from the revised DNA sequence
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCCCAGTCTTCTCCACATTGC | |
: AGGAGACGGAGTATGGCAGAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: GeneBridge 4 | |
: TCCCAGTCTTCTCCACATTGC | |
: AGGAGACGGAGTATGGCAGAC | |
: 212 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |