HUGE

Gene/Protein Characteristic Table for KIAA0804

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB018347
Description :	Vacuolar protein sorting-associated protein 8 homolog.
HUGO Gene Name :
Clone Name :	hk01186 [Vector Info]
Flexi ORF Clone :	pF1KA0804
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4217 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 579 bp

Genome contig ID gi89161205f_185950416
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
CCCTTTCTAACAATAAATGCTCCGTGTTTAAGTTC
Flanking genome sequence
(302672 - 302721)
----+----*----+----*----+----*----+----*----+----*
TGCAGGTCTCCTGGCTGGCTGGCTCTCAGTCTGTCAAGTCATGGAGGACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 186049662 186253086 40 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1211 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF85112	100.0	unnamed protein...	Homo sapiens
NP_001009921	100.0	vacuolar protei...	Homo sapiens
Q8N3P4	100.0	Vacuolar protei...	Homo sapiens
CAD38698	99.9	hypothetical pr...	Homo sapiens
BAG10385	99.9	vacuolar protei...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001841 1041 1074 PF00097 Zinc finger

HMMSmart IPR001841 1041 1092 SM00184 Zinc finger

ProfileScan IPR001841 1041 1093 PS50089 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	1041	1074	PF00097	Zinc finger
HMMSmart	IPR001841	1041	1092	SM00184	Zinc finger
ProfileScan	IPR001841	1041	1093	PS50089	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCCAGTCTTCTCCACATTGC

Primer_r
: AGGAGACGGAGTATGGCAGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCCCAGTCTTCTCCACATTGC
Primer_r	: AGGAGACGGAGTATGGCAGAC
PCR product length	: 212 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	579 bp
Genome contig ID	gi89161205f_185950416
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CCCTTTCTAACAATAAATGCTCCGTGTTTAAGTTC
Flanking genome sequence (302672 - 302721)	----+--------+--------+--------+--------+----* TGCAGGTCTCCTGGCTGGCTGGCTCTCAGTCTGTCAAGTCATGGAGGACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	186049662	186253086	40	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0804

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information