HUGE

Gene/Protein Characteristic Table for KIAA0820

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00134
Accession No. :	AB020627
Description :	Dynamin-3.
HUGO Gene Name :	dynamin 3 (DNM3)
Clone Name :	bg00036 [Vector Info]
Flexi ORF Clone :	pF1KA0820
Source :	Human adult brain
Note :	We replaced hh02540, former representative clones for KIAA0820 with bg00036. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6407 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3697 bp

Genome contig ID gi89161185f_169977290
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GATATACATAGTCATTTTTCCTCTATGGTAGAAGT
Flanking genome sequence
(670013 - 670062)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGGACATAGCAACATTAAAGTAGTGGATTTTTCTGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 170077290 170647301 19 99.3 Internal No-hit

Features of the protein sequence	Description

Length: 892 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH74079	100.0	dynamin 3 [Homo...	Homo sapiens
NP_056384	99.5	dynamin 3 isofo...	Homo sapiens
CAB66647	99.2	hypothetical pr...	Homo sapiens
XP_001100178	99.1	similar to dyna...	Macaca mulatta
EAW90915	99.5	dynamin 3, isof...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011139	0.00014	23.6	KIAA0567

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001401 64 82 PR00195 Dynamin

IPR001401 89 106 PR00195 Dynamin

IPR001401 159 176 PR00195 Dynamin

IPR001401 209 227 PR00195 Dynamin

IPR001401 228 244 PR00195 Dynamin

IPR001401 251 270 PR00195 Dynamin

HMMPfam IPR001401 67 240 PF00350 Dynamin

IPR000375 249 542 PF01031 Dynamin central region

IPR001849 549 654 PF00169 Pleckstrin-like

IPR003130 677 768 PF02212 Dynamin GTPase effector

HMMSmart IPR001401 39 278 SM00053 Dynamin

IPR001849 549 656 SM00233 Pleckstrin-like

IPR003130 677 768 SM00302 Dynamin GTPase effector

ProfileScan IPR001849 548 654 PS50003 Pleckstrin-like

ScanRegExp IPR001401 90 99 PS00410 Dynamin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001401	64	82	PR00195	Dynamin
IPR001401	89	106	PR00195	Dynamin
IPR001401	159	176	PR00195	Dynamin
IPR001401	209	227	PR00195	Dynamin
IPR001401	228	244	PR00195	Dynamin
IPR001401	251	270	PR00195	Dynamin
HMMPfam	IPR001401	67	240	PF00350	Dynamin
IPR000375	249	542	PF01031	Dynamin central region
IPR001849	549	654	PF00169	Pleckstrin-like
IPR003130	677	768	PF02212	Dynamin GTPase effector
HMMSmart	IPR001401	39	278	SM00053	Dynamin
IPR001849	549	656	SM00233	Pleckstrin-like
IPR003130	677	768	SM00302	Dynamin GTPase effector
ProfileScan	IPR001849	548	654	PS50003	Pleckstrin-like
ScanRegExp	IPR001401	90	99	PS00410	Dynamin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTCCAGATTGTAGTCATTTTG

Primer_r
: GGTCTCCAGAGGTTTTACTTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGTCTCCAGAGGTTTTACTTC
Primer_r	: CTCCAGATTGTAGTCATTTTG
PCR product length	: 161 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3697 bp
Genome contig ID	gi89161185f_169977290
PolyA signal sequence (None)	+--------+--------+----*----+---- GATATACATAGTCATTTTTCCTCTATGGTAGAAGT
Flanking genome sequence (670013 - 670062)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGGACATAGCAACATTAAAGTAGTGGATTTTTCTGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	170077290	170647301	19	99.3	Internal No-hit

Gene/Protein Characteristic Table for KIAA0820

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information