HUGE

Gene/Protein Characteristic Table for KIAA0833

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00650
Accession No. :	AB020640
Description :	Calmodulin-binding transcription activator 1.
HUGO Gene Name :	calmodulin binding transcription activator 1 (CAMTA1)
Clone Name :	hg01719s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0833
Source :	Human adult brain
Note :	We replaced hj04851 and hg01719, former representative clones for KIAA0833 with hg01719s1. (2001/5/29,2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6582 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1353 bp

Genome contig ID gi89161185f_6667971
PolyA signal sequence
(ACTAAA,-10)
+----*----+----*----+----*----+----
TAGGAGAACATTTTGCTAAAGCATGACTAAACTGC
Flanking genome sequence
(1082521 - 1082570)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAGAGCTACTGTATTTAGACTTAGGAAAAAAGGCAGAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 6767971 7750490 21 99.5 Internal No-hit

Features of the protein sequence	Description

Length: 1734 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y6Y1	100.0	Calmodulin-bind...	Homo sapiens
XP_001915249	96.5	calmodulin bind...	Equus caballus
CAM24365	94.0	calmodulin bind...	Mus musculus
A2A891	93.6	Calmodulin-bind...	Mus musculus
EAW71581	100.0	hCG21816, isofo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020716	8.4e-54	42.3	KIAA0909

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005559 128 244 PF03859 CG-1

IPR002909 934 1013 PF01833 Cell surface receptor IPT/TIG

IPR002110 1125 1147 PF00023 Ankyrin

IPR002110 1170 1190 PF00023 Ankyrin

IPR000048 1609 1629 PF00612 IQ calmodulin-binding region

IPR000048 1632 1652 PF00612 IQ calmodulin-binding region

ProfileScan IPR002110 1125 1147 PS50088 Ankyrin

IPR002110 1125 1224 PS50297 Ankyrin

IPR000048 1631 1657 PS50096 IQ calmodulin-binding region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005559	128	244	PF03859	CG-1
IPR002909	934	1013	PF01833	Cell surface receptor IPT/TIG
IPR002110	1125	1147	PF00023	Ankyrin
IPR002110	1170	1190	PF00023	Ankyrin
IPR000048	1609	1629	PF00612	IQ calmodulin-binding region
IPR000048	1632	1652	PF00612	IQ calmodulin-binding region
ProfileScan	IPR002110	1125	1147	PS50088	Ankyrin
IPR002110	1125	1224	PS50297	Ankyrin
IPR000048	1631	1657	PS50096	IQ calmodulin-binding region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCGAGAAAAATGTGGATGTAC

Primer_r
: CATTTTACAGACCATAGCCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCGAGAAAAATGTGGATGTAC
Primer_r	: CATTTTACAGACCATAGCCAC
PCR product length	: 123 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1353 bp
Genome contig ID	gi89161185f_6667971
PolyA signal sequence (ACTAAA,-10)	+--------+--------+----*----+---- TAGGAGAACATTTTGCTAAAGCATGACTAAACTGC
Flanking genome sequence (1082521 - 1082570)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGAGCTACTGTATTTAGACTTAGGAAAAAAGGCAGAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	6767971	7750490	21	99.5	Internal No-hit

Gene/Protein Characteristic Table for KIAA0833

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information