HUGE

Gene/Protein Characteristic Table for KIAA0909

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01135
Accession No. :	AB020716
Description :	Calmodulin-binding transcription activator 2.
HUGO Gene Name :	calmodulin binding transcription activator 2 (CAMTA2)
Clone Name :	hk10471 [Vector Info]
Flexi ORF Clone :	pF1KA0909
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4465 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 758 bp

Genome contig ID gi51511734r_4712017
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
GGTTTATACGAATTGCCATTAAACATCGCTGCACC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGCCAGCCTCCGGCCTCTGTCTGCGGGGGCGGGGCGGGGCCTAGGCCAGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 4812017 4831645 23 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1234 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11256	100.0	calmodulin-bind...	synthetic construct
EAW90372	99.9	hCG1986010, iso...	Homo sapiens
O94983	99.8	Calmodulin-bind...	Homo sapiens
AAI42696	99.7	Calmodulin bind...	Homo sapiens
EAW90371	99.3	hCG1986010, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020640	1.2e-33	42.3	KIAA0833

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005559 66 182 PF03859 CG-1

IPR002909 565 646 PF01833 Cell surface receptor IPT/TIG

IPR002110 742 762 PF00023 Ankyrin

IPR002110 787 807 PF00023 Ankyrin

IPR002110 821 841 PF00023 Ankyrin

IPR000048 1134 1154 PF00612 IQ calmodulin-binding region

ProfileScan IPR002110 742 841 PS50297 Ankyrin

IPR000048 1133 1159 PS50096 IQ calmodulin-binding region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005559	66	182	PF03859	CG-1
IPR002909	565	646	PF01833	Cell surface receptor IPT/TIG
IPR002110	742	762	PF00023	Ankyrin
IPR002110	787	807	PF00023	Ankyrin
IPR002110	821	841	PF00023	Ankyrin
IPR000048	1134	1154	PF00612	IQ calmodulin-binding region
ProfileScan	IPR002110	742	841	PS50297	Ankyrin
IPR000048	1133	1159	PS50096	IQ calmodulin-binding region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGAGGGGTCTTGTACATACTG

Primer_r
: AAGTAGAAAGTGCCCGTGGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGAGGGGTCTTGTACATACTG
Primer_r	: AAGTAGAAAGTGCCCGTGGAG
PCR product length	: 141 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	758 bp
Genome contig ID	gi51511734r_4712017
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- GGTTTATACGAATTGCCATTAAACATCGCTGCACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCCAGCCTCCGGCCTCTGTCTGCGGGGGCGGGGCGGGGCCTAGGCCAGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	4812017	4831645	23	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0909

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information