HUGE

Gene/Protein Characteristic Table for KIAA0844

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00654
Accession No. :	AB020651
Description :	Talanin.
HUGO Gene Name :	zinc finger protein 365 (ZNF365)
Clone Name :	hk05227 [Vector Info]
Flexi ORF Clone :	pF1KSDA0844
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4158 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2657 bp

Genome contig ID gi89161187f_63703957
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGAAATATTATGATAATAAAGCTATATTTCTGACT
Flanking genome sequence
(128258 - 128307)
----+----*----+----*----+----*----+----*----+----*
AATGTGTTGATATGTTTTGTCTAGTTGGAGTGTTTTTTGGGGAGCCAAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 63803957 63832213 5 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 438 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI46100	2.5e-148	100.0	hypothetical pr...	Homo sapiens
Q70YC5	7.1e-147	100.0	Protein ZNF365.	Homo sapiens
EAW54234	1.2e-146	99.8	zinc finger pro...	Homo sapiens
XP_001165752	7.9e-146	99.3	zinc finger pro...	Pan troglodytes
Q5R9L2	1.1e-143	98.0	Protein ZNF365.	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075820	2.3e-10	39.5	KIAA1940

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGTATGTTGTGCCTCCTTAG

Primer_r
: ACAGGACATGGTACTTAGCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2657 bp
Genome contig ID	gi89161187f_63703957
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGAAATATTATGATAATAAAGCTATATTTCTGACT
Flanking genome sequence (128258 - 128307)	----+--------+--------+--------+--------+----* AATGTGTTGATATGTTTTGTCTAGTTGGAGTGTTTTTTGGGGAGCCAAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	63803957	63832213	5	99.2	Perfect prediction

Primer_f	: ATGTATGTTGTGCCTCCTTAG
Primer_r	: ACAGGACATGGTACTTAGCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0844

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information