HUGE

Gene/Protein Characteristic Table for KIAA1940

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05001
Accession No. :	AB075820
Description :	F-box only protein 41.
HUGO Gene Name :	F-box protein 41 (FBXO41)
Clone Name :	ah04227 [Vector Info]
Source :	Human brain (amygdala)

Features of the cloned DNA sequence	Description

Length: 5627 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3161 bp

Genome contig ID gi89161199r_73236457
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TCTGAGCCAGCCCCTCAGGAATTGCCTCAAAAGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAACAAAAAAAAGTCCTCCTTCCCAAGGCCTGCTACTCCAAGGTTTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 73336457 73350104 12 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 821 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8TF61	100.0	F-box only prot...	Homo sapiens
EAW99736	99.9	hCG1776403 [Hom...	Homo sapiens
NP_001073879	99.9	F-box protein 4...	Homo sapiens
XP_001103806	99.4	F-box protein 4...	Macaca mulatta
EDL91195	96.8	rCG56391 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020651	6.7e-06	39.5	KIAA0844

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001810 494 540 PF00646 Cyclin-like F-box

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001810	494	540	PF00646	Cyclin-like F-box

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCTTTATTCAGGCTGCTTCCC

Primer_r
: TTGATCCTTAGGTGGTCTCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3161 bp
Genome contig ID	gi89161199r_73236457
PolyA signal sequence (None)	+--------+--------+----*----+---- TCTGAGCCAGCCCCTCAGGAATTGCCTCAAAAGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAACAAAAAAAAGTCCTCCTTCCCAAGGCCTGCTACTCCAAGGTTTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	73336457	73350104	12	99.9	Perfect prediction

Primer_f	: GCTTTATTCAGGCTGCTTCCC
Primer_r	: TTGATCCTTAGGTGGTCTCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1940

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information