HUGE

Gene/Protein Characteristic Table for KIAA0857

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00661
Accession No. :	AB020664
Description :	Rab11 family-interacting protein 5.
HUGO Gene Name :	RAB11 family interacting protein 5 (class I) (RAB11FIP5)
Clone Name :	hk06227 [Vector Info]
Flexi ORF Clone :	pF1KSDA0857
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4341 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2138 bp

Genome contig ID gi89161199r_73054019
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AGCACTTTATGAAGAATAAAACATTCATGTACTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGGTGGCTCTGTTGTGTTCCTGTTTTGGAATGAACAGTTACAGGAGGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 73154019 73193654 5 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 733 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001103469	0	97.7	similar to RAB1...	Macaca mulatta
Q9BXF6	0	100.0	Rab11 family-in...	Homo sapiens
AAH35013	0	99.5	RAB11 family in...	Homo sapiens
XP_616110	1.4e-211	90.2	similar to RAB1...	Bos taurus
XP_001917193	2.2e-205	88.8	RAB11 family in...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023158	1.8e-13	30.9	KIAA0941

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000008 101 165 PF00168 C2 calcium-dependent membrane targeting

HMMSmart IPR000008 100 223 SM00239 C2 calcium-dependent membrane targeting

ProfileScan IPR000008 97 208 PS50004 C2 calcium-dependent membrane targeting

ScanRegExp IPR001753 81 101 PS00166 Crotonase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	101	165	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	100	223	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	97	208	PS50004	C2 calcium-dependent membrane targeting
ScanRegExp	IPR001753	81	101	PS00166	Crotonase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGAGGTGCTGAAGAAGGATAC

Primer_r
: AAAGCATGACTGAAACCCTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCCTCTGGGCTTTATTCACTC
Primer_r	: GAAACATCAACAAGGACCCTG
PCR product length	: 122 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2138 bp
Genome contig ID	gi89161199r_73054019
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AGCACTTTATGAAGAATAAAACATTCATGTACTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGGTGGCTCTGTTGTGTTCCTGTTTTGGAATGAACAGTTACAGGAGGCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	73154019	73193654	5	99.3	Perfect prediction

Primer_f	: TGAGGTGCTGAAGAAGGATAC
Primer_r	: AAAGCATGACTGAAACCCTGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0857

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information