HUGE

Gene/Protein Characteristic Table for KIAA0941

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00692
Accession No. :	AB023158
Description :	Rab11 family-interacting protein 2.
HUGO Gene Name :	RAB11 family interacting protein 2 (class I) (RAB11FIP2)
Clone Name :	hh04956 [Vector Info]
Flexi ORF Clone :	pF1KSDA0941
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6059 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4080 bp

Genome contig ID gi89161187r_119654419
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
TTATTGACTTATAGTTGATTAAAGTGTTTAAACTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTCAGTTGTCAACATTTATTACAGATACAGCGGTGTTACCATAATGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 119754419 119796104 5 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 533 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q7L804	3.5e-206	100.0	Rab11 family-in...	Homo sapiens
XP_001152274	1.3e-205	99.6	RAB11 family in...	Pan troglodytes
XP_535026	9.5e-198	94.4	similar to Rab1...	Canis lupus fam...
XP_001494294	5.5e-197	94.5	similar to Rab1...	Equus caballus
EDL94565	2.2e-195	93.4	RAB11 family in...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020664	7.4e-18	30.9	KIAA0857
AB011110	0.00033	27.5	KIAA0538

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000008 51 63 PR00360 C2 calcium-dependent membrane targeting

IPR000008 75 88 PR00360 C2 calcium-dependent membrane targeting

HMMPfam IPR000008 36 123 PF00168 C2 calcium-dependent membrane targeting

HMMSmart IPR000008 35 138 SM00239 C2 calcium-dependent membrane targeting

ProfileScan IPR000008 36 123 PS50004 C2 calcium-dependent membrane targeting

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	51	63	PR00360	C2 calcium-dependent membrane targeting
IPR000008	75	88	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR000008	36	123	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	35	138	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	36	123	PS50004	C2 calcium-dependent membrane targeting

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTCTTGTAGGTGGTAGGTGTC

Primer_r
: AGCAGCACTGTGATCCTTTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTCTTGTAGGTGGTAGGTGTC
Primer_r	: AGCAGCACTGTGATCCTTTCC
PCR product length	: 105 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4080 bp
Genome contig ID	gi89161187r_119654419
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- TTATTGACTTATAGTTGATTAAAGTGTTTAAACTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTCAGTTGTCAACATTTATTACAGATACAGCGGTGTTACCATAATGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	119754419	119796104	5	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0941

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information