HUGE

Gene/Protein Characteristic Table for KIAA0538

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB011110
Description :	Ras GTPase-activating protein 4.
HUGO Gene Name :	RAS p21 protein activator 4 (RASA4)
Clone Name :	hg03944 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6169 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 3127 bp

Genome contig ID gi89161213r_101945203
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TGAACTTTTCAAGAATAAAAAAGCTTAAAAAGTAT
Flanking genome sequence
(61966 - 61917)
----+----*----+----*----+----*----+----*----+----*
ACATGGCCTGGTCCTACCAGAGACTCACCCAATGCCAGCCTCCAGCCAGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 102007169 102044396 21 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 816 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O43374	99.8	Ras GTPase-acti...	Homo sapiens
AAK31582	99.6	calcium-promote...	Homo sapiens
AAI10874	99.6	RAS p21 protein...	Homo sapiens
NP_008920	99.6	RAS p21 protein...	Homo sapiens
AAI43585	99.3	RAS p21 protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037763	4.6e-09	29.0	KIAA1342
AB067525	9.4e-08	25.0	KIAA1938
AB018290	2.1e-07	25.7	KIAA0747
D42055	2.1e-06	31.1	KIAA0093
AB033082	3.7e-06	23.5	KIAA1256

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000008 163 175 PR00360 C2 calcium-dependent membrane targeting

IPR000008 187 200 PR00360 C2 calcium-dependent membrane targeting

IPR000008 209 217 PR00360 C2 calcium-dependent membrane targeting

HMMPfam IPR000008 20 101 PF00168 C2 calcium-dependent membrane targeting

IPR000008 148 229 PF00168 C2 calcium-dependent membrane targeting

IPR001936 336 525 PF00616 Ras GTPase-activating protein

IPR001849 580 686 PF00169 Pleckstrin-like

IPR001562 688 724 PF00779 Tec/Btk

HMMSmart IPR000008 19 116 SM00239 C2 calcium-dependent membrane targeting

IPR000008 147 244 SM00239 C2 calcium-dependent membrane targeting

IPR001936 257 618 SM00323 Ras GTPase-activating protein

IPR001849 580 688 SM00233 Pleckstrin-like

IPR001562 688 724 SM00107 Tec/Btk

ProfileScan IPR000008 18 101 PS50004 C2 calcium-dependent membrane targeting

IPR000008 142 229 PS50004 C2 calcium-dependent membrane targeting

IPR001936 315 525 PS50018 Ras GTPase-activating protein

IPR001849 579 686 PS50003 Pleckstrin-like

IPR001562 688 724 PS51113 Tec/Btk

ScanRegExp IPR001936 481 495 PS00509 Ras GTPase-activating protein

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	163	175	PR00360	C2 calcium-dependent membrane targeting
IPR000008	187	200	PR00360	C2 calcium-dependent membrane targeting
IPR000008	209	217	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR000008	20	101	PF00168	C2 calcium-dependent membrane targeting
IPR000008	148	229	PF00168	C2 calcium-dependent membrane targeting
IPR001936	336	525	PF00616	Ras GTPase-activating protein
IPR001849	580	686	PF00169	Pleckstrin-like
IPR001562	688	724	PF00779	Tec/Btk
HMMSmart	IPR000008	19	116	SM00239	C2 calcium-dependent membrane targeting
IPR000008	147	244	SM00239	C2 calcium-dependent membrane targeting
IPR001936	257	618	SM00323	Ras GTPase-activating protein
IPR001849	580	688	SM00233	Pleckstrin-like
IPR001562	688	724	SM00107	Tec/Btk
ProfileScan	IPR000008	18	101	PS50004	C2 calcium-dependent membrane targeting
IPR000008	142	229	PS50004	C2 calcium-dependent membrane targeting
IPR001936	315	525	PS50018	Ras GTPase-activating protein
IPR001849	579	686	PS50003	Pleckstrin-like
IPR001562	688	724	PS51113	Tec/Btk
ScanRegExp	IPR001936	481	495	PS00509	Ras GTPase-activating protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CAACAGCAGCTCATAGACACG

Primer_r
: ACAGGATAAAGGTGAGGAATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAACAGCAGCTCATAGACACG
Primer_r	: ACAGGATAAAGGTGAGGAATG
PCR product length	: 132 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	3127 bp
Genome contig ID	gi89161213r_101945203
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TGAACTTTTCAAGAATAAAAAAGCTTAAAAAGTAT
Flanking genome sequence (61966 - 61917)	----+--------+--------+--------+--------+----* ACATGGCCTGGTCCTACCAGAGACTCACCCAATGCCAGCCTCCAGCCAGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	102007169	102044396	21	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0538

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information