HUGE

Gene/Protein Characteristic Table for KIAA1256

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00207
Accession No. :	AB033082
Description :	Intersectin-2.
HUGO Gene Name :	intersectin 2 (ITSN2)
Clone Name :	hh15293 [Vector Info]
Flexi ORF Clone :	pF1KA1256
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5938 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 760 bp

Genome contig ID gi89161199r_24179239
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
ACAGAAAGAGAATAAAGACATATGTTTATGGATGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTTCGTCAAAGTCTGACTGATTTACTTTCTATATGAAAGCTGCTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 24279239 24436808 39 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1676 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAF63600	100.0	intersectin 2 [...	Homo sapiens
BAG10443	100.0	intersectin-2 [...	synthetic construct
EAX00753	99.9	intersectin 2, ...	Homo sapiens
AAI46780	100.0	Intersectin 2 [...	Homo sapiens
XP_532890	94.4	similar to inte...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002380	2.2e-05	28.6	KIAA0382
AB002378	9.9e-05	26.5	KIAA0380
D63476	0.00063	24.5	KIAA0142
AB029035	0.00093	23.4	KIAA1112

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR002048 255 312 PD000012 Calcium-binding EF-hand

IPR001452 741 793 PD000066 Src homology-3

IPR001452 881 930 PD000066 Src homology-3

IPR001452 965 1013 PD000066 Src homology-3

IPR001452 1043 1091 PD000066 Src homology-3

IPR001452 1110 1160 PD000066 Src homology-3

FPrintScan IPR000108 1050 1069 PR00499 Neutrophil cytosol factor 2

IPR001452 1109 1119 PR00452 Src homology-3

IPR000108 1111 1131 PR00499 Neutrophil cytosol factor 2

IPR001452 1123 1138 PR00452 Src homology-3

IPR000108 1131 1147 PR00499 Neutrophil cytosol factor 2

IPR001452 1140 1149 PR00452 Src homology-3

IPR000108 1147 1160 PR00499 Neutrophil cytosol factor 2

IPR001452 1151 1163 PR00452 Src homology-3

IPR000008 1565 1577 PR00360 C2 calcium-dependent membrane targeting

IPR000008 1589 1602 PR00360 C2 calcium-dependent membrane targeting

HMMPfam IPR002048 64 92 PF00036 Calcium-binding EF-hand

IPR002048 287 315 PF00036 Calcium-binding EF-hand

IPR001452 741 795 PF00018 Src homology-3

IPR011511 881 933 PF07653 Variant SH3

IPR001452 963 1016 PF00018 Src homology-3

IPR001452 1035 1094 PF00018 Src homology-3

IPR001452 1109 1163 PF00018 Src homology-3

IPR000219 1192 1373 PF00621 DH

IPR001849 1414 1523 PF00169 Pleckstrin-like

IPR000008 1550 1631 PF00168 C2 calcium-dependent membrane targeting

HMMSmart IPR000261 21 115 SM00027 EPS15 homology (EH)

IPR002048 64 92 SM00054 Calcium-binding EF-hand

IPR000261 243 338 SM00027 EPS15 homology (EH)

IPR002048 287 315 SM00054 Calcium-binding EF-hand

IPR001452 739 796 SM00326 Src homology-3

IPR001452 880 934 SM00326 Src homology-3

IPR001452 963 1017 SM00326 Src homology-3

IPR001452 1035 1095 SM00326 Src homology-3

IPR001452 1109 1164 SM00326 Src homology-3

IPR000219 1192 1373 SM00325 DH

IPR001849 1414 1525 SM00233 Pleckstrin-like

IPR000008 1549 1646 SM00239 C2 calcium-dependent membrane targeting

ProfileScan IPR000261 28 116 PS50031 EPS15 homology (EH)

IPR002048 60 95 PS50222 Calcium-binding EF-hand

IPR000261 250 339 PS50031 EPS15 homology (EH)

IPR002048 283 318 PS50222 Calcium-binding EF-hand

IPR001452 736 797 PS50002 Src homology-3

IPR001452 877 935 PS50002 Src homology-3

IPR001452 960 1018 PS50002 Src homology-3

IPR001452 1032 1096 PS50002 Src homology-3

IPR001452 1106 1165 PS50002 Src homology-3

IPR000219 1188 1374 PS50010 DH

IPR001849 1413 1523 PS50003 Pleckstrin-like

IPR000008 1549 1631 PS50004 C2 calcium-dependent membrane targeting

ScanRegExp IPR002048 73 85 PS00018 Calcium-binding EF-hand

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	255	312	PD000012	Calcium-binding EF-hand
IPR001452	741	793	PD000066	Src homology-3
IPR001452	881	930	PD000066	Src homology-3
IPR001452	965	1013	PD000066	Src homology-3
IPR001452	1043	1091	PD000066	Src homology-3
IPR001452	1110	1160	PD000066	Src homology-3
FPrintScan	IPR000108	1050	1069	PR00499	Neutrophil cytosol factor 2
IPR001452	1109	1119	PR00452	Src homology-3
IPR000108	1111	1131	PR00499	Neutrophil cytosol factor 2
IPR001452	1123	1138	PR00452	Src homology-3
IPR000108	1131	1147	PR00499	Neutrophil cytosol factor 2
IPR001452	1140	1149	PR00452	Src homology-3
IPR000108	1147	1160	PR00499	Neutrophil cytosol factor 2
IPR001452	1151	1163	PR00452	Src homology-3
IPR000008	1565	1577	PR00360	C2 calcium-dependent membrane targeting
IPR000008	1589	1602	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR002048	64	92	PF00036	Calcium-binding EF-hand
IPR002048	287	315	PF00036	Calcium-binding EF-hand
IPR001452	741	795	PF00018	Src homology-3
IPR011511	881	933	PF07653	Variant SH3
IPR001452	963	1016	PF00018	Src homology-3
IPR001452	1035	1094	PF00018	Src homology-3
IPR001452	1109	1163	PF00018	Src homology-3
IPR000219	1192	1373	PF00621	DH
IPR001849	1414	1523	PF00169	Pleckstrin-like
IPR000008	1550	1631	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000261	21	115	SM00027	EPS15 homology (EH)
IPR002048	64	92	SM00054	Calcium-binding EF-hand
IPR000261	243	338	SM00027	EPS15 homology (EH)
IPR002048	287	315	SM00054	Calcium-binding EF-hand
IPR001452	739	796	SM00326	Src homology-3
IPR001452	880	934	SM00326	Src homology-3
IPR001452	963	1017	SM00326	Src homology-3
IPR001452	1035	1095	SM00326	Src homology-3
IPR001452	1109	1164	SM00326	Src homology-3
IPR000219	1192	1373	SM00325	DH
IPR001849	1414	1525	SM00233	Pleckstrin-like
IPR000008	1549	1646	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000261	28	116	PS50031	EPS15 homology (EH)
IPR002048	60	95	PS50222	Calcium-binding EF-hand
IPR000261	250	339	PS50031	EPS15 homology (EH)
IPR002048	283	318	PS50222	Calcium-binding EF-hand
IPR001452	736	797	PS50002	Src homology-3
IPR001452	877	935	PS50002	Src homology-3
IPR001452	960	1018	PS50002	Src homology-3
IPR001452	1032	1096	PS50002	Src homology-3
IPR001452	1106	1165	PS50002	Src homology-3
IPR000219	1188	1374	PS50010	DH
IPR001849	1413	1523	PS50003	Pleckstrin-like
IPR000008	1549	1631	PS50004	C2 calcium-dependent membrane targeting
ScanRegExp	IPR002048	73	85	PS00018	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCCTCCGAACAGACAACATTA

Primer_r
: GTAGCTTCAATGACATGCACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	760 bp
Genome contig ID	gi89161199r_24179239
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ACAGAAAGAGAATAAAGACATATGTTTATGGATGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTTCGTCAAAGTCTGACTGATTTACTTTCTATATGAAAGCTGCTTTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	24279239	24436808	39	100.0	Perfect prediction

Primer_f	: CCCTCCGAACAGACAACATTA
Primer_r	: GTAGCTTCAATGACATGCACC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1256

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information