HUGE

Gene/Protein Characteristic Table for KIAA0382

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04163
Accession No. :	AB002380
Description :	Rho guanine nucleotide exchange factor 12.
HUGO Gene Name :	Rho guanine nucleotide exchange factor (GEF) 12 (ARHGEF12)
Clone Name :	ef00443 [Vector Info]
Source :
Note :	We replaced hh00685, former representative clones for KIAA0382 with ef00443. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 8283 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3951 bp

Genome contig ID gi51511727f_119697727
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
AAAATAAGATTTCAAATATTAAATAAGCTTAAAGG
Flanking genome sequence
(167222 - 167271)
----+----*----+----*----+----*----+----*----+----*
AACCAAGCATGTGACTTTTTATTTGTATTCTGGTTGATTTGTCTTGTCCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 119797727 119864947 36 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1443 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NZN5	100.0	Rho guanine nuc...	Homo sapiens
XP_001166795	99.9	Rho guanine nuc...	Pan troglodytes
XP_001166830	99.9	Rho guanine nuc...	Pan troglodytes
XP_508820	99.9	Rho guanine nuc...	Pan troglodytes
XP_001917643	92.5	similar to guan...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002378	5.3e-64	32.6	KIAA0380
AB014551	2e-16	25.5	KIAA0651
AB018263	1.4e-15	23.4	KIAA0720
AB011093	1.7e-15	28.0	KIAA0521
AB033082	3.8e-13	28.8	KIAA1256

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001478 1 44 PF00595 PDZ/DHR/GLGF

IPR015212 267 457 PF09128 Regulator of G protein signalling-like domain

IPR000219 690 875 PF00621 DH

HMMSmart IPR000219 690 875 SM00325 DH

IPR001849 919 1033 SM00233 Pleckstrin-like

ProfileScan IPR001478 1 35 PS50106 PDZ/DHR/GLGF

IPR000219 686 876 PS50010 DH

IPR001849 918 1031 PS50003 Pleckstrin-like

ScanRegExp IPR001331 825 850 PS00741 Guanine-nucleotide dissociation stimulator

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	1	44	PF00595	PDZ/DHR/GLGF
IPR015212	267	457	PF09128	Regulator of G protein signalling-like domain
IPR000219	690	875	PF00621	DH
HMMSmart	IPR000219	690	875	SM00325	DH
IPR001849	919	1033	SM00233	Pleckstrin-like
ProfileScan	IPR001478	1	35	PS50106	PDZ/DHR/GLGF
IPR000219	686	876	PS50010	DH
IPR001849	918	1031	PS50003	Pleckstrin-like
ScanRegExp	IPR001331	825	850	PS00741	Guanine-nucleotide dissociation stimulator

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GTGTTCTATCAGCGAGTATCC

Primer_r
: GTCAGCAAATCTTCCCCAATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTGTTCTATCAGCGAGTATCC
Primer_r	: GTCAGCAAATCTTCCCCAATC
PCR product length	: 176 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3951 bp
Genome contig ID	gi51511727f_119697727
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- AAAATAAGATTTCAAATATTAAATAAGCTTAAAGG
Flanking genome sequence (167222 - 167271)	----+--------+--------+--------+--------+----* AACCAAGCATGTGACTTTTTATTTGTATTCTGGTTGATTTGTCTTGTCCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	119797727	119864947	36	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0382

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information