| HUGE |
Gene/Protein Characteristic Table for KIAA0382 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK04163 |
|---|---|
| Accession No. : | AB002380 |
| Description : | Rho guanine nucleotide exchange factor 12. |
| HUGO Gene Name : | Rho guanine nucleotide exchange factor (GEF) 12 (ARHGEF12) |
| Clone Name : | ef00443 [Vector Info] |
| Source : | |
| Note : | We replaced hh00685, former representative clones for KIAA0382 with ef00443. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 8283 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3951 bp Genome contig ID gi51511727f_119697727 PolyA signal sequence
(ATTAAA,-18) +----*----+----*----+----*----+----
AAAATAAGATTTCAAATATTAAATAAGCTTAAAGGFlanking genome sequence
(167222 - 167271) ----+----*----+----*----+----*----+----*----+----*
AACCAAGCATGTGACTTTTTATTTGTATTCTGGTTGATTTGTCTTGTCCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 f 119797727 119864947 36 99.5 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1443 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : GTGTTCTATCAGCGAGTATCC | |
| : GTCAGCAAATCTTCCCCAATC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 11 |
| : GeneBridge 4 | |
| : GTGTTCTATCAGCGAGTATCC | |
| : GTCAGCAAATCTTCCCCAATC | |
| : 176 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |