HUGE |
Gene/Protein Characteristic Table for KIAA0651 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01109 |
---|---|
Accession No. : | AB014551 |
Description : | Rho/Rac guanine nucleotide exchange factor 2. |
HUGO Gene Name : | rho/rac guanine nucleotide exchange factor (GEF) 2 (ARHGEF2) |
Clone Name : | sj09778 [Vector Info] |
Flexi ORF Clone : | pF1KA0651
![]() |
Source : | |
Note : | We replaced hk01046, former representative clones for KIAA0651 with sj09778. (1999/12/25) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4434 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1087 bp Genome contig ID gi89161185r_154083270 PolyA signal sequence
(ATTAAA,-19) +----*----+----*----+----*----+----
AAAAAATTCAGGGAAAATTAAAAACCTGGAACTCCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATAAGGTACTGTCTTCCATAATGTCTGCCAATTCTGAGGAGGATGGTAGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 154183270 154226488 26 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1114 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GCCTCCTATCTCCACATCTCT | |
: GGGAAGAGGTCAGTATAGGTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: GCCTCCTATCTCCACATCTCT | |
: GGGAAGAGGTCAGTATAGGTC | |
: 100 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |