HUGE

Gene/Protein Characteristic Table for KIAA0651

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01109
Accession No. :	AB014551
Description :	Rho/Rac guanine nucleotide exchange factor 2.
HUGO Gene Name :	rho/rac guanine nucleotide exchange factor (GEF) 2 (ARHGEF2)
Clone Name :	sj09778 [Vector Info]
Flexi ORF Clone :	pF1KA0651
Source :
Note :	We replaced hk01046, former representative clones for KIAA0651 with sj09778. (1999/12/25)

Features of the cloned DNA sequence	Description

Length: 4434 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1087 bp

Genome contig ID gi89161185r_154083270
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
AAAAAATTCAGGGAAAATTAAAAACCTGGAACTCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATAAGGTACTGTCTTCCATAATGTCTGCCAATTCTGAGGAGGATGGTAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 154183270 154226488 26 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1114 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11223	100.0	Rho/Rac guanine...	synthetic construct
EAW53012	100.0	rho/rac guanine...	Homo sapiens
AAL96658	99.9	guanine nucleot...	Homo sapiens
EAW53018	99.7	rho/rac guanine...	Homo sapiens
EAW53016	99.7	rho/rac guanine...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011093	6.9e-59	37.2	KIAA0521
AB002378	1.2e-18	24.9	KIAA0380
AB002380	6.8e-18	25.5	KIAA0382
AB018263	3.1e-05	22.5	KIAA0720
AB033082	0.00054	26.3	KIAA1256

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002219 169 219 PF00130 Protein kinase C

IPR000219 367 559 PF00621 DH

IPR001849 601 699 PF00169 Pleckstrin-like

HMMSmart IPR002219 169 215 SM00109 Protein kinase C

IPR000219 367 559 SM00325 DH

IPR001849 601 701 SM00233 Pleckstrin-like

ProfileScan IPR002219 168 215 PS50081 Protein kinase C

IPR000219 363 560 PS50010 DH

IPR001849 600 699 PS50003 Pleckstrin-like

ScanRegExp IPR002219 169 215 PS00479 Protein kinase C

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002219	169	219	PF00130	Protein kinase C
IPR000219	367	559	PF00621	DH
IPR001849	601	699	PF00169	Pleckstrin-like
HMMSmart	IPR002219	169	215	SM00109	Protein kinase C
IPR000219	367	559	SM00325	DH
IPR001849	601	701	SM00233	Pleckstrin-like
ProfileScan	IPR002219	168	215	PS50081	Protein kinase C
IPR000219	363	560	PS50010	DH
IPR001849	600	699	PS50003	Pleckstrin-like
ScanRegExp	IPR002219	169	215	PS00479	Protein kinase C

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GCCTCCTATCTCCACATCTCT

Primer_r
: GGGAAGAGGTCAGTATAGGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCCTCCTATCTCCACATCTCT
Primer_r	: GGGAAGAGGTCAGTATAGGTC
PCR product length	: 100 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1087 bp
Genome contig ID	gi89161185r_154083270
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- AAAAAATTCAGGGAAAATTAAAAACCTGGAACTCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATAAGGTACTGTCTTCCATAATGTCTGCCAATTCTGAGGAGGATGGTAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	154183270	154226488	26	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0651

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information