HUGE

Gene/Protein Characteristic Table for KIAA0720

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK01114
Accession No. :	AB018263
Description :	pleckstrin homology domain containing family G member 5 isoform b.
HUGO Gene Name :	pleckstrin homology domain containing, family G (with RhoGef domain) member 5 (PLEKHG5)
Clone Name :	hk01741s1 [Vector Info]
Flexi ORF Clone :	pF1KA0720
Source :	Human adult brain
Note :	We replaced hk01741, former representative clones for KIAA0720 with hk01741s1. (1999/6/16)

Features of the cloned DNA sequence	Description

Length: 4749 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1471 bp

Genome contig ID gi89161185r_6348739
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GGGCGCCCGTCGGAGGGCTATGGAGCAGCGGCCGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GGGGCTGCGCGGCGGTGGCGGCGGTGAGTTGAGACGCAGGAGGCTAGGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 6448739 6480059 22 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1091 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI16069	99.2	pleckstrin homo...	Homo sapiens
BAG11230	100.0	pleckstrin homo...	synthetic construct
O94827	99.9	Pleckstrin homo...	Homo sapiens
BAG53269	99.0	unnamed protein...	Homo sapiens
BAH11909	99.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002380	2e-09	23.8	KIAA0382
AB002378	6.5e-07	24.3	KIAA0380

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000219 425 612 PF00621 DH

IPR001849 670 769 PF00169 Pleckstrin-like

HMMSmart IPR000219 425 612 SM00325 DH

IPR001849 670 771 SM00233 Pleckstrin-like

ProfileScan IPR000219 421 613 PS50010 DH

IPR001849 669 769 PS50003 Pleckstrin-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	425	612	PF00621	DH
IPR001849	670	769	PF00169	Pleckstrin-like
HMMSmart	IPR000219	425	612	SM00325	DH
IPR001849	670	771	SM00233	Pleckstrin-like
ProfileScan	IPR000219	421	613	PS50010	DH
IPR001849	669	769	PS50003	Pleckstrin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCCTGGCTCTACCTTGAAGTG
Primer_r	: GACAGGCCAAGTAGAACACGC
PCR product length	: 130 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1471 bp
Genome contig ID	gi89161185r_6348739
PolyA signal sequence (None)	+--------+--------+----*----+---- GGGCGCCCGTCGGAGGGCTATGGAGCAGCGGCCGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GGGGCTGCGCGGCGGTGGCGGCGGTGAGTTGAGACGCAGGAGGCTAGGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	6448739	6480059	22	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0720

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information