HUGE |
Gene/Protein Characteristic Table for KIAA0720 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK01114 |
---|---|
Accession No. : | AB018263 |
Description : | pleckstrin homology domain containing family G member 5 isoform b. |
HUGO Gene Name : | pleckstrin homology domain containing, family G (with RhoGef domain) member 5 (PLEKHG5) |
Clone Name : | hk01741s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0720 |
Source : | Human adult brain |
Note : | We replaced hk01741, former representative clones for KIAA0720 with hk01741s1. (1999/6/16) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4749 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1471 bp Genome contig ID gi89161185r_6348739 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GGGCGCCCGTCGGAGGGCTATGGAGCAGCGGCCGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
GGGGCTGCGCGGCGGTGGCGGCGGTGAGTTGAGACGCAGGAGGCTAGGGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 6448739 6480059 22 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1091 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: CCCTGGCTCTACCTTGAAGTG | |
: GACAGGCCAAGTAGAACACGC | |
: 130 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |