HUGE |
Gene/Protein Characteristic Table for KIAA1112 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00742 |
---|---|
Accession No. : | AB029035 |
Description : | Rho guanine nucleotide exchange factor 4. |
HUGO Gene Name : | Rho guanine nucleotide exchange factor (GEF) 4 (ARHGEF4) |
Clone Name : | hj05505s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1112
![]() |
Source : | Human adult brain |
Note : | We replaced hj05505, former representative clones for KIAA1112 with hj05505s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3800 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1713 bp Genome contig ID gi89161199f_131291474 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
CCACATTTAATTTCATAAATAAATTTATGAAAAGTFlanking genome sequence
(229822 - 229871) ----+----*----+----*----+----*----+----*----+----*
AACCTGGCTGCTAGCCCGTTTTCTGTGGGTGTGCGTGCATTTTCCTGTGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 131391474 131521294 12 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 694 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GCGTGAGAAGCCATAAGAGAG | |
: AATGTGGTTTCTGGCTTGGAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 2 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |