HUGE |
Gene/Protein Characteristic Table for KIAA1415 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06477 |
---|---|
Accession No. : | AB037836 |
Description : | Phosphatidylinositol 3,4,5-trisphosphate-dependent Rac exchanger 1 protein. |
HUGO Gene Name : | phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1 (PREX1) |
Clone Name : | hg04328s1 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hg04328, former representative clones for KIAA1415 with hg04328s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6496 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1630 bp Genome contig ID gi51511747r_46574200 PolyA signal sequence
(ATTAAA,-22) +----*----+----*----+----*----+----
ATTTTTTATTATTATTAAAAGTCAGTTTATAATACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAGAACGAGGCTGTGATCTGCTTCATCTGCGGTGGGTGGCTTGGGGGGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 r 46674200 46877690 40 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1621 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TTCCTTCAACGTCCACATTCC | |
: TTTTCCAAGTCCACCAAGCAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 20 |
: GeneBridge 4 | |
: TTCCTTCAACGTCCACATTCC | |
: TTTTCCAAGTCCACCAAGCAG | |
: 107 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |