| HUGE | 
Gene/Protein Characteristic Table for KIAA0337 | 
| 
Link to : 
Rouge | 
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK04164 | 
|---|---|
| Accession No. : | AB002335 | 
| Description : | Rho guanine nucleotide exchange factor 17. | 
| HUGO Gene Name : | Rho guanine nucleotide exchange factor (GEF) 17 (ARHGEF17) | 
| Clone Name : | hg01226 [Vector Info] | 
| Source : | Human adult brain | 
Features of the cloned DNA sequence | 
Description | |
|---|---|---|
Length: 6289 bp
 
       | 
| cloned DNA seq. | |
Warning for N-terminal truncation:  | NO | 
Warning for coding interruption:  | NO | 
Features of the protein sequence | 
Description | |
|---|---|---|
Length: 1609 aa
![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
    Expression profile | 
Description | |
|---|---|---|
| RT-PCR | Description | 
|---|
| : CCACCCACCCCAAACAAAACC | |
| : TCTACCTGACCCCCTGGACCA | |
| : 95 °C | 
RH mapping information | 
Description | |
|---|---|---|
| : 11 | 
| : GeneBridge 4 | |
| : CCACCCACCCCAAACAAAACC | |
| : TCTACCTGACCCCCTGGACCA | |
| : 137 bp | |
| : 95 °C | 
| 
 
 How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage  
 
  | |