HUGE

Gene/Protein Characteristic Table for KIAA0337

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04164
Accession No. :	AB002335
Description :	Rho guanine nucleotide exchange factor 17.
HUGO Gene Name :	Rho guanine nucleotide exchange factor (GEF) 17 (ARHGEF17)
Clone Name :	hg01226 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6289 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1609 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96PE2	99.9	Rho guanine nuc...	Homo sapiens
XP_001115376	96.5	similar to Rho ...	Macaca mulatta
XP_001917491	93.2	Rho guanine nuc...	Equus caballus
XP_851853	93.1	similar to Rho ...	Canis lupus fam...
EDL16482	89.6	mCG116432, isof...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046846	7e-13	23.5	KIAA1626
AB002292	4.8e-12	23.8	KIAA0294
AB028989	8e-09	24.0	KIAA1066
AB011088	1.3e-08	23.9	KIAA0516
AB037836	3.8e-07	30.9	KIAA1415

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000219 616 799 PF00621 DH

HMMSmart IPR000219 616 799 SM00325 DH

ProfileScan IPR000219 612 800 PS50010 DH

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	616	799	PF00621	DH
HMMSmart	IPR000219	616	799	SM00325	DH
ProfileScan	IPR000219	612	800	PS50010	DH

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CCACCCACCCCAAACAAAACC

Primer_r
: TCTACCTGACCCCCTGGACCA

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCACCCACCCCAAACAAAACC
Primer_r	: TCTACCTGACCCCCTGGACCA
PCR product length	: 137 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0337

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information