| HUGE | 
Gene/Protein Characteristic Table for KIAA0516 | 
| 
Link to : 
Rouge | 
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK06955 | 
|---|---|
| Accession No. : | AB011088 | 
| Description : | C-jun-amino-terminal kinase-interacting protein 4. | 
| HUGO Gene Name : | sperm associated antigen 9 (SPAG9) | 
| Clone Name : | hg00484s2 [Vector Info] | 
| Source : | Human adult brain | 
| Note : | We replaced hg00484 and hg00484s1, former representative clones for KIAA0516 with hg00484s2. (2002/5/10,2005/08/06) | 
Features of the cloned DNA sequence | 
Description | |
|---|---|---|
Length: 4437 bp
 
       | 
| cloned DNA seq. | |
Warning for N-terminal truncation:  | YES | 
Warning for coding interruption:  | NO | 
Length of 3'UTR 284 bp Genome contig ID gi51511734r_46298348 PolyA signal sequence 
(None) +----*----+----*----+----*----+----
CAAACTGGTGAATTATAGAAAGCAATCCAGATGTGFlanking genome sequence 
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
GTTTACTCTGCCACAGTCTAATGTCATTCACTTCATTTGATGGGGTCACT
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 46398348 46553203 30 100.0 Perfect prediction 
Features of the protein sequence | 
Description | |
|---|---|---|
Length: 1382 aa
![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Motif_DB | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| None | - | - | - | - | - | 
| Method | No. | N terminal | transmembrane region | C terminal | type | length | 
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - | 
Expression profile | 
Description | |
|---|---|---|
| RT-PCR | Description | 
|---|
| : CTCGGGACATTTAGATACATC | |
| : TGGGGTCACTTGTTAGCTGTC | |
| : 95 °C | 
RH mapping information | 
Description | |
|---|---|---|
| : 17 | 
| : GeneBridge 4 | |
| : CTCGGGACATTTAGATACATC | |
| : TGGGGTCACTTGTTAGCTGTC | |
| : 162 bp | |
| : 95 °C | 
| 
 
 How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage  
 
  | |