HUGE |
Gene/Protein Characteristic Table for KIAA0294 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01064 |
---|---|
Accession No. : | AB002292 |
Description : | Rho guanine nucleotide exchange factor 10. |
HUGO Gene Name : | Rho guanine nucleotide exchange factor (GEF) 10 (ARHGEF10) |
Clone Name : | hf00223s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0294 |
Source : | Human adult brain |
Note : | We replaced hf00223, former representative clones for KIAA0294 with hf00223s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5589 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1370 bp Genome contig ID gi51511724f_1678924 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
GCTGTCTGACTTCATCAATAAAGTATTTTTATTTTFlanking genome sequence
(215284 - 215333) ----+----*----+----*----+----*----+----*----+----*
AAAATGCAGTAGGATGAGTTGCCTCTTTTCTGTGTCAAGTGGAAAGGGAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 8 f 1759549 1894206 29 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1405 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: TCTTAAAATCTACCGCCAACG | |
: ACACCTCCATCTACTATTCGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 8 |
: GeneBridge 4 | |
: TCTTAAAATCTACCGCCAACG | |
: ACACCTCCATCTACTATTCGG | |
: 110 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |