HUGE

Gene/Protein Characteristic Table for KIAA1362

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05017
Accession No. :	AB037783
Description :	FYVE, RhoGEF and PH domain-containing protein 6.
HUGO Gene Name :
Clone Name :	fj02381 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3842 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1741 bp

Genome contig ID gi89161190r_93898158
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTCCAGCCTGGGATGACAGAGCGAGACTCCATCTC
Flanking genome sequence
(99718 - 99669)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAATTGAACAGCAAGGTTATCCATATAATAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 93997876 94127187 20 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 699 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC87464	99.9	unnamed protein...	Homo sapiens
Q6ZV73	99.9	FYVE, RhoGEF an...	Homo sapiens
BAC85990	99.7	unnamed protein...	Homo sapiens
XP_509275	99.3	FYVE, RhoGEF an...	Pan troglodytes
XP_001142099	99.3	FYVE, RhoGEF an...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018336	3.6e-21	28.2	KIAA0793
AB002335	9.1e-11	26.0	KIAA0337
AB002303	7e-09	30.6	KIAA0305
AB002292	9.3e-08	25.8	KIAA0294
AB037836	1.4e-07	25.4	KIAA1415

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000219 207 391 PF00621 DH

IPR001849 422 515 PF00169 Pleckstrin-like

IPR000306 549 614 PF01363 Zinc finger

HMMSmart IPR000219 207 391 SM00325 DH

IPR001849 422 517 SM00233 Pleckstrin-like

IPR000306 546 614 SM00064 Zinc finger

ProfileScan IPR000219 203 392 PS50010 DH

IPR001849 421 515 PS50003 Pleckstrin-like

IPR000306 554 613 PS50178 Zinc finger

IPR001849 665 699 PS50003 Pleckstrin-like

ScanRegExp IPR001304 560 584 PS00615 C-type lectin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	207	391	PF00621	DH
IPR001849	422	515	PF00169	Pleckstrin-like
IPR000306	549	614	PF01363	Zinc finger
HMMSmart	IPR000219	207	391	SM00325	DH
IPR001849	422	517	SM00233	Pleckstrin-like
IPR000306	546	614	SM00064	Zinc finger
ProfileScan	IPR000219	203	392	PS50010	DH
IPR001849	421	515	PS50003	Pleckstrin-like
IPR000306	554	613	PS50178	Zinc finger
IPR001849	665	699	PS50003	Pleckstrin-like
ScanRegExp	IPR001304	560	584	PS00615	C-type lectin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAAGTCTGTTACAAGCCTCTG

Primer_r
: ACATTTGCATCAGCGTCCTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAAGTCTGTTACAAGCCTCTG
Primer_r	: ACATTTGCATCAGCGTCCTCC
PCR product length	: 159 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1741 bp
Genome contig ID	gi89161190r_93898158
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGATGACAGAGCGAGACTCCATCTC
Flanking genome sequence (99718 - 99669)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAATTGAACAGCAAGGTTATCCATATAATAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	93997876	94127187	20	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1362

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information