HUGE

Gene/Protein Characteristic Table for KIAA0305

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00047
Accession No. :	AB002303
Description :	Zinc finger FYVE domain-containing protein 16.
HUGO Gene Name :	zinc finger, FYVE domain containing 16 (ZFYVE16)
Clone Name :	hg00042 [Vector Info]
Flexi ORF Clone :	pF1KA0305
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6632 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1764 bp

Genome contig ID gi51511721f_79639648
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTATGTGCCTGAAGTTTGGAGGCACATTTTGAAGT
Flanking genome sequence
(171069 - 171118)
----+----*----+----*----+----*----+----*----+----*
ATTCTTTGTAGACATATAGTATGTTTCTGAATGTGTTTGTTACTTATTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 79739648 79810715 19 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1547 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q7Z3T8	100.0	Zinc finger FYV...	Homo sapiens
NP_055548	99.9	zinc finger, FY...	Homo sapiens
CAI45932	99.9	hypothetical pr...	Homo sapiens
CAD97666	99.9	hypothetical pr...	Homo sapiens
XP_001135982	98.4	endosome-associ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037783	6.7e-10	30.0	KIAA1362
AB014547	1.6e-07	36.2	KIAA0647
AB040970	9.6e-07	21.8	KIAA1537
AB002369	3.4e-06	44.4	KIAA0371
AB002319	4.8e-06	28.0	KIAA0321

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000306 750 814 PF01363 Zinc finger

HMMSmart IPR000306 747 814 SM00064 Zinc finger

ProfileScan IPR000306 755 813 PS50178 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000306	750	814	PF01363	Zinc finger
HMMSmart	IPR000306	747	814	SM00064	Zinc finger
ProfileScan	IPR000306	755	813	PS50178	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CTTCAAAATGTGCCTCCAAAC

Primer_r
: GTAGAGGGCTGTTCCATGATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTTCAAAATGTGCCTCCAAAC
Primer_r	: GTAGAGGGCTGTTCCATGATG
PCR product length	: 108 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1764 bp
Genome contig ID	gi51511721f_79639648
PolyA signal sequence (None)	+--------+--------+----*----+---- TTATGTGCCTGAAGTTTGGAGGCACATTTTGAAGT
Flanking genome sequence (171069 - 171118)	----+--------+--------+--------+--------+----* ATTCTTTGTAGACATATAGTATGTTTCTGAATGTGTTTGTTACTTATTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	79739648	79810715	19	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0305

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information