HUGE

Gene/Protein Characteristic Table for KIAA0371

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01077
Accession No. :	AB002369
Description :	Myotubularin-related protein 3.
HUGO Gene Name :	myotubularin related protein 3 (MTMR3)
Clone Name :	hh00252 [Vector Info]
Flexi ORF Clone :	pF1KA0371
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5886 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1203 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q13615	100.0	Myotubularin-re...	Homo sapiens
BAF82270	99.9	unnamed protein...	Homo sapiens
AAI51218	99.9	Myotubularin re...	Homo sapiens
XP_001138185	99.8	myotubularin-re...	Pan troglodytes
XP_001107561	98.1	similar to myot...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014547	1.5e-161	49.5	KIAA0647
AB028996	6.1e-38	38.3	KIAA1073
AB051469	9.6e-12	34.9	KIAA1682
AB040970	2.9e-07	26.8	KIAA1537
AB046863	3.3e-07	24.9	KIAA1643

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010569 190 352 PF06602 Myotubularin-related

IPR000306 1119 1185 PF01363 Zinc finger

HMMSmart IPR003595 365 514 SM00404 Protein-tyrosine phosphatase

IPR000306 1116 1185 SM00064 Zinc finger

ProfileScan IPR000306 1124 1184 PS50178 Zinc finger

ScanRegExp IPR000387 416 428 PS00383 Protein-tyrosine phosphatase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010569	190	352	PF06602	Myotubularin-related
IPR000306	1119	1185	PF01363	Zinc finger
HMMSmart	IPR003595	365	514	SM00404	Protein-tyrosine phosphatase
IPR000306	1116	1185	SM00064	Zinc finger
ProfileScan	IPR000306	1124	1184	PS50178	Zinc finger
ScanRegExp	IPR000387	416	428	PS00383	Protein-tyrosine phosphatase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AATATAGGAGCACTGACTGAC

Primer_r
: GGTTTCTTGGGTCTGATGTAC

PCR conditions
: 95 °C30 sec61 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AATATAGGAGCACTGACTGAC
Primer_r	: GGTTTCTTGGGTCTGATGTAC
PCR product length	: 176 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0371

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information