HUGE

Gene/Protein Characteristic Table for KIAA1682

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00265
Accession No. :	AB051469
Description :	myotubularin related protein 12.
HUGO Gene Name :	myotubularin related protein 12 (MTMR12)
Clone Name :	fh23774 [Vector Info]
Flexi ORF Clone :	pF1KA1682
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5034 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2687 bp

Genome contig ID gi51511721r_32162869
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
TGATTGCAGAAATTAAAGCACAATTTACAAGCAAT
Flanking genome sequence
(285936 - 285887)
----+----*----+----*----+----*----+----*----+----*
GCTGGGATTACAATACAGGCATGAGCCACCGTGCCCGCCCCAGAAAATTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 32256535 32348804 19 98.6 Terminal No-hit

Features of the protein sequence	Description

Length: 775 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001089010	98.8	similar to phos...	Macaca mulatta
Q9C0I1	100.0	Myotubularin-re...	Homo sapiens
AAK26171	99.9	phosphatidylino...	Homo sapiens
Q5R989	98.5	Myotubularin-re...	Pongo abelii
XP_855452	93.8	similar to myot...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028996	8.7e-16	27.6	KIAA1073
AB002369	1.1e-14	34.9	KIAA0371
AB014547	1.7e-13	32.2	KIAA0647

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010569 261 325 PF06602 Myotubularin-related

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010569	261	325	PF06602	Myotubularin-related

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTCCAGCGACATTCCTCTAAG

Primer_r
: TAGCGTGACACAAATCCAGGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: "5,11"

Experimental conditions

Panel name	: CCR
Primer_f	: GTTTGTTGTTACCGCATATCG
Primer_r	: CTTCTCTTGTAAACTCTGGAC
PCR product length	: 158 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2687 bp
Genome contig ID	gi51511721r_32162869
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- TGATTGCAGAAATTAAAGCACAATTTACAAGCAAT
Flanking genome sequence (285936 - 285887)	----+--------+--------+--------+--------+----* GCTGGGATTACAATACAGGCATGAGCCACCGTGCCCGCCCCAGAAAATTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	32256535	32348804	19	98.6	Terminal No-hit

Primer_f	: CTCCAGCGACATTCCTCTAAG
Primer_r	: TAGCGTGACACAAATCCAGGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1682

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information