HUGE |
Gene/Protein Characteristic Table for KIAA1682 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00265 |
---|---|
Accession No. : | AB051469 |
Description : | myotubularin related protein 12. |
HUGO Gene Name : | myotubularin related protein 12 (MTMR12) |
Clone Name : | fh23774 [Vector Info] |
Flexi ORF Clone : | pF1KA1682
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5034 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2687 bp Genome contig ID gi51511721r_32162869 PolyA signal sequence
(ATTAAA,-24) +----*----+----*----+----*----+----
TGATTGCAGAAATTAAAGCACAATTTACAAGCAATFlanking genome sequence
(285936 - 285887) ----+----*----+----*----+----*----+----*----+----*
GCTGGGATTACAATACAGGCATGAGCCACCGTGCCCGCCCCAGAAAATTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 r 32256535 32348804 19 98.6 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 775 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTCCAGCGACATTCCTCTAAG | |
: TAGCGTGACACAAATCCAGGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: "5,11" |
: CCR | |
: GTTTGTTGTTACCGCATATCG | |
: CTTCTCTTGTAAACTCTGGAC | |
: 158 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |