HUGE |
Gene/Protein Characteristic Table for KIAA0647 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01600 |
---|---|
Accession No. : | AB014547 |
Description : | myotubularin related protein 4. |
HUGO Gene Name : | myotubularin related protein 4 (MTMR4) |
Clone Name : | hj03819s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0647 |
Source : | Human adult brain |
Note : | We replaced hj03819, former representative clones for KIAA0647 with hj03819s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5719 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2131 bp Genome contig ID gi51511734r_53821892 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
ATACAGTTTAAATAAAATCTCTATATTAGTGCTGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TTTGTTGGGTCGTTTTATTTTCATTTCTAAAAAAACTTAATATTCACTTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 53921892 53945303 17 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1195 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: TATCTGTCTACTTAGCGTGGC | |
: GTCACTTACACCCACAACAGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 17 |
: GeneBridge 4 | |
: TATCTGTCTACTTAGCGTGGC | |
: GTCACTTACACCCACAACAGC | |
: 141 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |