HUGE

Gene/Protein Characteristic Table for KIAA1073

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01624
Accession No. :	AB028996
Description :	Myotubularin-related protein 2.
HUGO Gene Name :	myotubularin related protein 2 (MTMR2)
Clone Name :	hj06550 [Vector Info]
Flexi ORF Clone :	pF1KSDA1073
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4680 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2407 bp

Genome contig ID gi51511727r_95105694
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TTGAAATGAATTGCAATAAAGCTCTGTTACAACGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTGGATGGATGACACATTCCTCTACTGTAAACTTGCAGATAAGAAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 95205694 95297107 15 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 675 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH52990	100.0	Myotubularin re...	Homo sapiens
BAF83966	99.8	unnamed protein...	Homo sapiens
Q13614	99.8	Myotubularin-re...	Homo sapiens
1LW3	99.7	Crystal Structu...	Homo sapiens
Q5REB9	99.4	Myotubularin-re...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002369	7e-47	38.5	KIAA0371
AB014547	8.2e-44	34.5	KIAA0647
AB051469	4.1e-16	27.6	KIAA1682

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004182 100 171 PF02893 GRAM

IPR010569 266 383 PF06602 Myotubularin-related

HMMSmart IPR004182 103 171 SM00568 GRAM

IPR003595 397 545 SM00404 Protein-tyrosine phosphatase

ProfileScan IPR000387 418 465 PS50056 Protein-tyrosine phosphatase

ScanRegExp IPR000387 447 459 PS00383 Protein-tyrosine phosphatase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004182	100	171	PF02893	GRAM
IPR010569	266	383	PF06602	Myotubularin-related
HMMSmart	IPR004182	103	171	SM00568	GRAM
IPR003595	397	545	SM00404	Protein-tyrosine phosphatase
ProfileScan	IPR000387	418	465	PS50056	Protein-tyrosine phosphatase
ScanRegExp	IPR000387	447	459	PS00383	Protein-tyrosine phosphatase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTGGTTCAGTCTGTCTTGTGC

Primer_r
: GGATGTCAGAGAAGGCAGTCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2407 bp
Genome contig ID	gi51511727r_95105694
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTGAAATGAATTGCAATAAAGCTCTGTTACAACGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTGGATGGATGACACATTCCTCTACTGTAAACTTGCAGATAAGAAAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	95205694	95297107	15	99.3	Perfect prediction

Primer_f	: TTGGTTCAGTCTGTCTTGTGC
Primer_r	: GGATGTCAGAGAAGGCAGTCG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1073

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information