HUGE

Gene/Protein Characteristic Table for KIAA0321

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07424
Accession No. :	AB002319
Description :	zinc finger, FYVE domain containing 26.
HUGO Gene Name :	zinc finger, FYVE domain containing 26 (ZFYVE26)
Clone Name :	hg00426 [Vector Info]
Flexi ORF Clone :	pF1KA0321
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6540 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1542 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q68DK2	100.0	Zinc finger FYV...	Homo sapiens
EAW80953	99.9	zinc finger, FY...	Homo sapiens
BAG72892	99.9	zinc finger, FY...	synthetic construct
BAG11658	99.9	FYVE domain con...	Homo sapiens
NP_056161	99.9	zinc finger, FY...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037783	8.6e-07	36.0	KIAA1362
AB002303	4.7e-05	28.0	KIAA0305
AB046863	0.00014	40.6	KIAA1643
AB040970	0.00036	33.3	KIAA1537
AB023210	0.00046	35.4	KIAA0993

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000306 810 876 PF01363 Zinc finger

HMMSmart IPR000306 807 876 SM00064 Zinc finger

ProfileScan IPR000306 815 875 PS50178 Zinc finger

ScanRegExp IPR007087 566 590 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000306	810	876	PF01363	Zinc finger
HMMSmart	IPR000306	807	876	SM00064	Zinc finger
ProfileScan	IPR000306	815	875	PS50178	Zinc finger
ScanRegExp	IPR007087	566	590	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TGGGTATCTGTTTTGGTGGTG

Primer_r
: CCTGACATTTTCCTCTAACTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGGGTATCTGTTTTGGTGGTG
Primer_r	: CCTGACATTTTCCTCTAACTC
PCR product length	: 137 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0321

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information