HUGE

Gene/Protein Characteristic Table for KIAA0993

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07349
Accession No. :	AB023210
Description :	WD repeat and FYVE domain-containing protein 3.
HUGO Gene Name :	WD repeat and FYVE domain containing 3 (WDFY3)
Clone Name :	bf03014 [Vector Info]
Source :	Human adult brain
Note :	We replaced hk07603, former representative clones for KIAA0993 with bf03014. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 7998 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3326 bp

Genome contig ID gi89161207r_85709719
PolyA signal sequence
(AATAAA,-30)
+----*----+----*----+----*----+----
TTTCAAATAAATACCTATTTACCACCAAAAGAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAGAAAAGTTGTTAAGTCAGTTATTCAGGGAAGGAAAAACAGAGATC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 85809719 85891723 33 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1556 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50247	100.0	WDFY3 protein [...	Homo sapiens
Q8IZQ1	100.0	WD repeat and F...	Homo sapiens
XP_001151618	99.9	WD repeat and F...	Pan troglodytes
AAN15137	99.9	ALFY [Homo sapi...	Homo sapiens
XP_001495037	98.1	WD repeat and F...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046827	1.1e-59	38.5	KIAA1607
AB046764	5.2e-53	39.8	KIAA1544
AB011112	2.3e-52	36.2	KIAA0540
AB014547	1.1e-06	29.1	KIAA0647
AB037783	3.2e-06	40.2	KIAA1362

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001680 1153 1186 PD000018 WD40 repeat

FPrintScan IPR001680 1123 1137 PR00320 WD40 repeat

IPR001680 1172 1186 PR00320 WD40 repeat

IPR001680 1262 1276 PR00320 WD40 repeat

HMMPfam IPR000409 725 1006 PF02138 Beige/BEACH

IPR001680 1147 1185 PF00400 WD40 repeat

IPR001680 1189 1226 PF00400 WD40 repeat

IPR001680 1232 1275 PF00400 WD40 repeat

IPR000306 1479 1545 PF01363 Zinc finger

HMMSmart IPR001680 1102 1136 SM00320 WD40 repeat

IPR001680 1146 1185 SM00320 WD40 repeat

IPR001680 1188 1226 SM00320 WD40 repeat

IPR001680 1231 1275 SM00320 WD40 repeat

IPR001680 1429 1468 SM00320 WD40 repeat

IPR000306 1476 1545 SM00064 Zinc finger

ProfileScan IPR000409 713 1006 PS50197 Beige/BEACH

IPR001680 1118 1284 PS50294 WD40 repeat

IPR001680 1153 1194 PS50082 WD40 repeat

IPR000306 1484 1544 PS50178 Zinc finger

ScanRegExp IPR001680 1172 1186 PS00678 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	1153	1186	PD000018	WD40 repeat
FPrintScan	IPR001680	1123	1137	PR00320	WD40 repeat
IPR001680	1172	1186	PR00320	WD40 repeat
IPR001680	1262	1276	PR00320	WD40 repeat
HMMPfam	IPR000409	725	1006	PF02138	Beige/BEACH
IPR001680	1147	1185	PF00400	WD40 repeat
IPR001680	1189	1226	PF00400	WD40 repeat
IPR001680	1232	1275	PF00400	WD40 repeat
IPR000306	1479	1545	PF01363	Zinc finger
HMMSmart	IPR001680	1102	1136	SM00320	WD40 repeat
IPR001680	1146	1185	SM00320	WD40 repeat
IPR001680	1188	1226	SM00320	WD40 repeat
IPR001680	1231	1275	SM00320	WD40 repeat
IPR001680	1429	1468	SM00320	WD40 repeat
IPR000306	1476	1545	SM00064	Zinc finger
ProfileScan	IPR000409	713	1006	PS50197	Beige/BEACH
IPR001680	1118	1284	PS50294	WD40 repeat
IPR001680	1153	1194	PS50082	WD40 repeat
IPR000306	1484	1544	PS50178	Zinc finger
ScanRegExp	IPR001680	1172	1186	PS00678	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTAAGACTGGATTGATTGTGG

Primer_r
: ATATCACAGACTGCACACTAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3326 bp
Genome contig ID	gi89161207r_85709719
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- TTTCAAATAAATACCTATTTACCACCAAAAGAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAGAAAAGTTGTTAAGTCAGTTATTCAGGGAAGGAAAAACAGAGATC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	85809719	85891723	33	100.0	Perfect prediction

Primer_f	: CTAAGACTGGATTGATTGTGG
Primer_r	: ATATCACAGACTGCACACTAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0993

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information