HUGE |
Gene/Protein Characteristic Table for KIAA0540 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06104 |
---|---|
Accession No. : | AB011112 |
Description : | SQFE253. |
HUGO Gene Name : | neurobeachin-like 2 (NBEAL2) |
Clone Name : | pg00116 [Vector Info] |
Flexi ORF Clone : | pF1KA0540
![]() |
Source : | Human brain (hippocampus) |
Note : | We replaced hg04185, former representative clones for KIAA0540 with pg00116. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6364 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 236 bp Genome contig ID gi89161205f_46911815 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CCGCCCTGAGGGCCAGCACTGGCGTCTGCGGCCGCFlanking genome sequence
(114237 - 114286) ----+----*----+----*----+----*----+----*----+----*
AGCAGCACTTTTTGCACAGTCTGGGGCGGGGTTCCCCGGCTTCCAAGTCG
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 f 47011815 47026050 40 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2041 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GCACATCCTCCAACTAAACAC | |
: AGTAGGGTTGTATTCCGTCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: GeneBridge 4 | |
: GCACATCCTCCAACTAAACAC | |
: AGTAGGGTTGTATTCCGTCTC | |
: 247 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |