HUGE

Gene/Protein Characteristic Table for KIAA0142

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00426
Accession No. :	D63476
Description :	Rho guanine nucleotide exchange factor 7.
HUGO Gene Name :	Rho guanine nucleotide exchange factor (GEF) 7 (ARHGEF7)
Clone Name :	ha01169 [Vector Info]
Flexi ORF Clone :	pF1KSDA0142
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5032 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2618 bp

Genome contig ID gi51511729f_110504086
PolyA signal sequence
(ATTAAA,-26)
+----*----+----*----+----*----+----
GTTGTAATTATTAAACTGATTATTTTTCTTATGTC
Flanking genome sequence
(251995 - 252044)
----+----*----+----*----+----*----+----*----+----*
ACAGAATGTGTCGCTTCGTCTTCTTTGATGTGTTTTCTGTGTGCTTGTTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 f 110604086 110756079 20 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 802 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX09148	99.5	Rho guanine nuc...	Homo sapiens
BAH13248	99.7	unnamed protein...	Homo sapiens
AAH50521	99.9	Rho guanine nuc...	Homo sapiens
XP_509742	97.0	Rho guanine nuc...	Pan troglodytes
XP_001926031	94.5	similar to Rho ...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D25304	4.7e-59	59.4	KIAA0006
AB029035	1.9e-08	23.7	KIAA1112
AB033082	4.5e-07	24.5	KIAA1256
AB037836	1e-05	26.1	KIAA1415

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 166 216 PD000066 Src homology-3

FPrintScan IPR001452 179 194 PR00452 Src homology-3

IPR001452 196 205 PR00452 Src homology-3

IPR001452 207 219 PR00452 Src homology-3

HMMPfam IPR001452 165 219 PF00018 Src homology-3

IPR000219 253 428 PF00621 DH

IPR001849 458 556 PF00169 Pleckstrin-like

HMMSmart IPR001452 165 220 SM00326 Src homology-3

IPR000219 253 428 SM00325 DH

IPR001849 458 558 SM00233 Pleckstrin-like

ProfileScan IPR001452 162 221 PS50002 Src homology-3

IPR000219 249 429 PS50010 DH

IPR001849 451 556 PS50003 Pleckstrin-like

ScanRegExp IPR001331 377 402 PS00741 Guanine-nucleotide dissociation stimulator

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	166	216	PD000066	Src homology-3
FPrintScan	IPR001452	179	194	PR00452	Src homology-3
IPR001452	196	205	PR00452	Src homology-3
IPR001452	207	219	PR00452	Src homology-3
HMMPfam	IPR001452	165	219	PF00018	Src homology-3
IPR000219	253	428	PF00621	DH
IPR001849	458	556	PF00169	Pleckstrin-like
HMMSmart	IPR001452	165	220	SM00326	Src homology-3
IPR000219	253	428	SM00325	DH
IPR001849	458	558	SM00233	Pleckstrin-like
ProfileScan	IPR001452	162	221	PS50002	Src homology-3
IPR000219	249	429	PS50010	DH
IPR001849	451	556	PS50003	Pleckstrin-like
ScanRegExp	IPR001331	377	402	PS00741	Guanine-nucleotide dissociation stimulator

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GGGTTACTCCTTTGCTCTCAC
Primer_r	: AACCAGGGCAGGCATTCAAGG
PCR product length	: 190 bp
PCR conditions	: 95 °C15 sec64 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2618 bp
Genome contig ID	gi51511729f_110504086
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- GTTGTAATTATTAAACTGATTATTTTTCTTATGTC
Flanking genome sequence (251995 - 252044)	----+--------+--------+--------+--------+----* ACAGAATGTGTCGCTTCGTCTTCTTTGATGTGTTTTCTGTGTGCTTGTTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	f	110604086	110756079	20	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0142

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information