HUGE |
Gene/Protein Characteristic Table for KIAA0006 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04167 |
---|---|
Accession No. : | D25304 |
Description : | Rho guanine nucleotide exchange factor 6. |
HUGO Gene Name : | Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 (ARHGEF6) |
Clone Name : | ha01154 [Vector Info] |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4804 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2480 bp Genome contig ID gi89161218r_135475374 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
TCAATACATAAAAATAAACAGTGCTTTATAAAAATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAGTCTTTTGCTTCTTTTTTTGCTAGCCGGTGTGCAGAAAGATTTCTTGT
Features of the protein sequence |
Description | |
---|---|---|
Length: 773 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: X |
: Genebridge 4 | |
: AACGAAGCTTGTGCAGAGTG | |
: CCTCTACGGGCAGCAGTTTA | |
: 163 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |