HUGE |
Gene/Protein Characteristic Table for KIAA1938 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01186 |
---|---|
Accession No. : | AB067525 |
Description : | Ras GTPase-activating protein SynGAP. |
HUGO Gene Name : | synaptic Ras GTPase activating protein 1 homolog (rat) (SYNGAP1) |
Clone Name : | hg00912s1 [Vector Info] |
Flexi ORF Clone : | pF1KA1938 |
Source : | Human adult brain |
Note : | We replaced hg00912, former representative clones for KIAA1938 with hg00912s1. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 9768 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 5635 bp Genome contig ID gi89161210f_33396013 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
CTTAAAATTTTTTAATAAACTGTGCCCTGAAACCTFlanking genome sequence
(137285 - 137334) ----+----*----+----*----+----*----+----*----+----*
AAACTGACAGTGGACTGGATTGAGTAATTTGTGTGGGAGAGAATGTGAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 f 33495919 33533296 19 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1376 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AGACACCATCCACATTGAACC | |
: GTGAATCTCCTCCTCGTACTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 6 |
: GeneBridge 4 | |
: AGCTGAAGGCTGGAGAGTAAC | |
: CACCCCCGATTCCAGTATCTG | |
: 123 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |