HUGE

Gene/Protein Characteristic Table for KIAA1743

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00908
Accession No. :	AB051530
Description :	Disabled homolog 2-interacting protein.
HUGO Gene Name :	DAB2 interacting protein (DAB2IP)
Clone Name :	pj01380s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1743
Source :	Human brain (hippocampus)
Note :	We replaced pj01380, former representative clones for KIAA1743 with pj01380s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5094 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1983 bp

Genome contig ID gi89161216f_123459123
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
CAATTAGAAATATTAAAGATTTATTTAGCTATTTT
Flanking genome sequence
(128507 - 128556)
----+----*----+----*----+----*----+----*----+----*
AAGCCCGACTCGTGTCTCCATTCAGCTGTGTGTTAAGGGATGACCCTGAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 123559123 123587628 14 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1036 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAQ10386	100.0	DAB2 interactin...	Homo sapiens
EAW87504	100.0	DAB2 interactin...	Homo sapiens
EAW87502	100.0	DAB2 interactin...	Homo sapiens
AAK50336	100.0	nGAP-like prote...	Homo sapiens
EAW87501	100.0	DAB2 interactin...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067525	2.9e-35	50.0	KIAA1938

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 29 78 PF00169 Pleckstrin-like

IPR000008 91 171 PF00168 C2 calcium-dependent membrane targeting

IPR001936 268 439 PF00616 Ras GTPase-activating protein

HMMSmart IPR000008 90 186 SM00239 C2 calcium-dependent membrane targeting

IPR001936 196 533 SM00323 Ras GTPase-activating protein

ProfileScan IPR001849 1 78 PS50003 Pleckstrin-like

IPR001936 247 439 PS50018 Ras GTPase-activating protein

ScanRegExp IPR001936 395 409 PS00509 Ras GTPase-activating protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	29	78	PF00169	Pleckstrin-like
IPR000008	91	171	PF00168	C2 calcium-dependent membrane targeting
IPR001936	268	439	PF00616	Ras GTPase-activating protein
HMMSmart	IPR000008	90	186	SM00239	C2 calcium-dependent membrane targeting
IPR001936	196	533	SM00323	Ras GTPase-activating protein
ProfileScan	IPR001849	1	78	PS50003	Pleckstrin-like
IPR001936	247	439	PS50018	Ras GTPase-activating protein
ScanRegExp	IPR001936	395	409	PS00509	Ras GTPase-activating protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACGCGCAGTTGTTAGAAGACG

Primer_r
: TCATACTCCTCCAGCTTCTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1983 bp
Genome contig ID	gi89161216f_123459123
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- CAATTAGAAATATTAAAGATTTATTTAGCTATTTT
Flanking genome sequence (128507 - 128556)	----+--------+--------+--------+--------+----* AAGCCCGACTCGTGTCTCCATTCAGCTGTGTGTTAAGGGATGACCCTGAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	123559123	123587628	14	100.0	Perfect prediction

Primer_f	: ACGCGCAGTTGTTAGAAGACG
Primer_r	: TCATACTCCTCCAGCTTCTTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1743

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information