HUGE

Gene/Protein Characteristic Table for KIAA0859

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01611
Accession No. :	AB020666
Description :
HUGO Gene Name :
Clone Name :	hk06485s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0859
Source :	Human adult brain
Note :	We replaced hk06485, former representative clones for KIAA0859 with hk06485s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 2404 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 202 bp

Genome contig ID gi89161185f_169917629
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AATAAAAATGTCCTTCCCATCTTGTCCTCTTCAGT
Flanking genome sequence
(115094 - 115143)
----+----*----+----*----+----*----+----*----+----*
ACCACTTGGGTTGGTTTGTCTTTGCTTCCTACACCACGTCCTTGAGTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 170017629 170032721 8 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 707 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF84429	99.9	unnamed protein...	Homo sapiens
XP_001146517	99.6	CGI-01 protein ...	Pan troglodytes
BAG51342	99.6	unnamed protein...	Homo sapiens
BAG65285	100.0	unnamed protein...	Homo sapiens
XP_001146579	99.6	CGI-01 protein ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013216 61 166 PF08241 Methyltransferase type 11

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013216	61	166	PF08241	Methyltransferase type 11

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCCTAGACTGACCTTGGACTC

Primer_r
: AGAGGACAAGATGGGAAGGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	202 bp
Genome contig ID	gi89161185f_169917629
PolyA signal sequence (None)	+--------+--------+----*----+---- AATAAAAATGTCCTTCCCATCTTGTCCTCTTCAGT
Flanking genome sequence (115094 - 115143)	----+--------+--------+--------+--------+----* ACCACTTGGGTTGGTTTGTCTTTGCTTCCTACACCACGTCCTTGAGTGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	170017629	170032721	8	100.0	Perfect prediction

Primer_f	: GCCTAGACTGACCTTGGACTC
Primer_r	: AGAGGACAAGATGGGAAGGAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0859

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information