HUGE

Gene/Protein Characteristic Table for KIAA0864

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06032
Accession No. :	AB020671
Description :	Myosin phosphatase Rho-interacting protein.
HUGO Gene Name :
Clone Name :	hk06577s1 [Vector Info]
Flexi ORF Clone :	pF1KA0864
Source :	Human adult brain
Note :	We replaced hk06577, former representative clones for KIAA0864 with hk06577s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4872 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1402 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW55722	0	99.9	myosin phosphat...	Homo sapiens
XP_001160711	0	99.5	myosin phosphat...	Pan troglodytes
CAI24302	0	75.6	myosin phosphat...	Mus musculus
CAI24299	2.5e-124	85.1	myosin phosphat...	Mus musculus
XP_536669	1.4e-105	78.9	similar to myos...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051449	1.5e-18	45.0	KIAA1662

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGCTGTTAAGAGGAGAAAGTG

Primer_r
: GAAAGGTTTGCCACGACTCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGCTGTTAAGAGGAGAAAGTG
Primer_r	: GAAAGGTTTGCCACGACTCTC
PCR product length	: 115 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0864

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information