HUGE

Gene/Protein Characteristic Table for KIAA0873

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00667
Accession No. :	AB020680
Description :	BAG family molecular chaperone regulator 5.
HUGO Gene Name :
Clone Name :	hk07246 [Vector Info]
Flexi ORF Clone :	pF1KSDA0873
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4119 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2718 bp

Genome contig ID gi51511730r_102993192
PolyA signal sequence
(ATTAAA,-28)
+----*----+----*----+----*----+----
GGTCTGCATTAAACGCTGTAGTCCATGTTCATGCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAATGGCTGGGAACGTTTGCTTTATTTACATTCAGTCAGCGTTGCTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 103093192 103098734 2 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 466 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH44216	1.8e-176	99.1	BAG5 protein [H...	Homo sapiens
Q9UL15	1.3e-171	100.0	BAG family mole...	Homo sapiens
AAH50551	1.7e-170	99.8	BCL2-associated...	Homo sapiens
BAE02324	4.1e-170	98.9	unnamed protein...	Macaca fascicularis
XP_537562	6.6e-170	95.7	similar to BCL2...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003103 28 105 PF02179 Apoptosis regulator Bcl-2 protein

IPR003103 201 279 PF02179 Apoptosis regulator Bcl-2 protein

IPR003103 294 369 PF02179 Apoptosis regulator Bcl-2 protein

IPR003103 384 461 PF02179 Apoptosis regulator Bcl-2 protein

HMMSmart IPR003103 28 105 SM00264 Apoptosis regulator Bcl-2 protein

IPR003103 201 279 SM00264 Apoptosis regulator Bcl-2 protein

IPR003103 294 369 SM00264 Apoptosis regulator Bcl-2 protein

IPR003103 384 461 SM00264 Apoptosis regulator Bcl-2 protein

ProfileScan IPR003103 28 105 PS51035 Apoptosis regulator Bcl-2 protein

IPR003103 201 279 PS51035 Apoptosis regulator Bcl-2 protein

IPR003103 294 369 PS51035 Apoptosis regulator Bcl-2 protein

IPR003103 384 461 PS51035 Apoptosis regulator Bcl-2 protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003103	28	105	PF02179	Apoptosis regulator Bcl-2 protein
IPR003103	201	279	PF02179	Apoptosis regulator Bcl-2 protein
IPR003103	294	369	PF02179	Apoptosis regulator Bcl-2 protein
IPR003103	384	461	PF02179	Apoptosis regulator Bcl-2 protein
HMMSmart	IPR003103	28	105	SM00264	Apoptosis regulator Bcl-2 protein
IPR003103	201	279	SM00264	Apoptosis regulator Bcl-2 protein
IPR003103	294	369	SM00264	Apoptosis regulator Bcl-2 protein
IPR003103	384	461	SM00264	Apoptosis regulator Bcl-2 protein
ProfileScan	IPR003103	28	105	PS51035	Apoptosis regulator Bcl-2 protein
IPR003103	201	279	PS51035	Apoptosis regulator Bcl-2 protein
IPR003103	294	369	PS51035	Apoptosis regulator Bcl-2 protein
IPR003103	384	461	PS51035	Apoptosis regulator Bcl-2 protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CACCGGATTTAGCTCTTGTCG

Primer_r
: ATGGACTACAGCGTTTAATGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2718 bp
Genome contig ID	gi51511730r_102993192
PolyA signal sequence (ATTAAA,-28)	+--------+--------+----*----+---- GGTCTGCATTAAACGCTGTAGTCCATGTTCATGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATGGCTGGGAACGTTTGCTTTATTTACATTCAGTCAGCGTTGCTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	103093192	103098734	2	99.0	Perfect prediction

Primer_f	: CACCGGATTTAGCTCTTGTCG
Primer_r	: ATGGACTACAGCGTTTAATGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0873

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information