HUGE

Gene/Protein Characteristic Table for KIAA0889

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07672
Accession No. :	AB020696
Description :	Novel protein.
HUGO Gene Name :	chromosome 20 open reading frame 117 (C20orf117)
Clone Name :	hk08008 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4122 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 535 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB13954	1.9e-208	100.0	unnamed protein...	Homo sapiens
EAW76098	1.7e-187	99.8	chromosome 20 o...	Homo sapiens
O94964	9.7e-181	99.8	Uncharacterized...	Homo sapiens
EAW76099	9.9e-181	99.8	chromosome 20 o...	Homo sapiens
XP_514623	1.1e-180	99.8	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018345	1.2e-17	35.5	KIAA0802

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGCTCGACTGTTCCCCTTACC

Primer_r
: CTCCTTGGTGTCTTTCTCTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGCTCGACTGTTCCCCTTACC
Primer_r	: CTCCTTGGTGTCTTTCTCTGG
PCR product length	: 119 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0889

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information