HUGE

Gene/Protein Characteristic Table for KIAA0802

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00130
Accession No. :	AB018345
Description :
HUGO Gene Name :
Clone Name :	hh07536 [Vector Info]
Flexi ORF Clone :	pF1KA0802
Source :	Human adult brain
Note :	We replaced hh01783, former representative clones for KIAA0802 with hh07536. (1999/6/16)

Features of the cloned DNA sequence	Description

Length: 6009 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1189 bp

Genome contig ID gi51511735f_8597409
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GTGATGAAGTAGAAATAAAGCCCTTCTGAGATGGC
Flanking genome sequence
(225368 - 225417)
----+----*----+----*----+----*----+----*----+----*
AGCATGTCTCGGTCTCTCATTTCACACACCCTCCATCTTTTCCTAAGGAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 18 f 8697409 8822775 15 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1578 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX01613	99.9	hCG38133, isofo...	Homo sapiens
CAX15676	82.9	novel protein (...	Mus musculus
XP_237548	83.0	similar to Temp...	Rattus norvegicus
CAX15677	80.0	novel protein (...	Mus musculus
AAH60225	81.3	RIKEN cDNA 1110...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020696	6.5e-11	35.5	KIAA0889

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTTCATCACGGTCTCATACAG
Primer_r	: CGATGATCCAACAGCAACACC
PCR product length	: 167 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1189 bp
Genome contig ID	gi51511735f_8597409
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GTGATGAAGTAGAAATAAAGCCCTTCTGAGATGGC
Flanking genome sequence (225368 - 225417)	----+--------+--------+--------+--------+----* AGCATGTCTCGGTCTCTCATTTCACACACCCTCCATCTTTTCCTAAGGAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	18	f	8697409	8822775	15	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0802

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information