HUGE |
Gene/Protein Characteristic Table for KIAA0802 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00130 |
---|---|
Accession No. : | AB018345 |
Description : | |
HUGO Gene Name : | |
Clone Name : | hh07536 [Vector Info] |
Flexi ORF Clone : | pF1KA0802
![]() |
Source : | Human adult brain |
Note : | We replaced hh01783, former representative clones for KIAA0802 with hh07536. (1999/6/16) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6009 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1189 bp Genome contig ID gi51511735f_8597409 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
GTGATGAAGTAGAAATAAAGCCCTTCTGAGATGGCFlanking genome sequence
(225368 - 225417) ----+----*----+----*----+----*----+----*----+----*
AGCATGTCTCGGTCTCTCATTTCACACACCCTCCATCTTTTCCTAAGGAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 18 f 8697409 8822775 15 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1578 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
RH mapping information |
Description | |
---|---|---|
: 18 |
: GeneBridge 4 | |
: CTTCATCACGGTCTCATACAG | |
: CGATGATCCAACAGCAACACC | |
: 167 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |