HUGE

Gene/Protein Characteristic Table for KIAA0892

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01132
Accession No. :	AB020699
Description :
HUGO Gene Name :
Clone Name :	hk08289 [Vector Info]
Flexi ORF Clone :	pF1KA0892
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4164 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2297 bp

Genome contig ID gi42406306f_19192734
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GCACTCCAGCCTGGGTGACGGTGAGACTTTGTCTC
Flanking genome sequence
(137156 - 137205)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAACAATGGAAGGCAGACAGCAAGTCCCTGAGGACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 19292644 19329888 18 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 621 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI44991	98.9	9130404D08Rik p...	Mus musculus
EDL28773	98.6	RIKEN cDNA 9130...	Mus musculus
XP_512526	99.8	hypothetical pr...	Pan troglodytes
BAC33653	98.5	unnamed protein...	Mus musculus
BAC38382	98.5	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR013026 115 148 SM00028 Tetratricopeptide region

IPR013026 387 420 SM00028 Tetratricopeptide region

IPR013026 467 500 SM00028 Tetratricopeptide region

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR013026	115	148	SM00028	Tetratricopeptide region
IPR013026	387	420	SM00028	Tetratricopeptide region
IPR013026	467	500	SM00028	Tetratricopeptide region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACGGCGTGCATCATGTTCATC

Primer_r
: ATAGATAACAGGGTGGTCATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2297 bp
Genome contig ID	gi42406306f_19192734
PolyA signal sequence (None)	+--------+--------+----*----+---- GCACTCCAGCCTGGGTGACGGTGAGACTTTGTCTC
Flanking genome sequence (137156 - 137205)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAACAATGGAAGGCAGACAGCAAGTCCCTGAGGACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	19292644	19329888	18	99.1	Perfect prediction

Primer_f	: ACGGCGTGCATCATGTTCATC
Primer_r	: ATAGATAACAGGGTGGTCATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0892

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information