HUGE

Gene/Protein Characteristic Table for KIAA0897

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06447
Accession No. :	AB020704
Description :	Liprin-alpha-4.
HUGO Gene Name :
Clone Name :	hk09524 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3605 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2344 bp

Genome contig ID gi89161185f_201192658
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
ACGTACCAATAAACAACCTGGTTTTAAGACAATGT
Flanking genome sequence
(121830 - 121879)
----+----*----+----*----+----*----+----*----+----*
ACAAATGGCCTCCAGTCTTTTTTTTTTTTTTTTTTTTTTTTTTTAACTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 201292658 201314486 12 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 419 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O75335	2.2e-177	100.0	Liprin-alpha-4;...	Homo sapiens
EAW91462	2.7e-177	100.0	protein tyrosin...	Homo sapiens
ABR09268	3.3e-177	100.0	liprin alpha4 [...	Homo sapiens
CAH72276	3.3e-177	100.0	protein tyrosin...	Homo sapiens
BAG58587	1.2e-176	99.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014554	1.4e-100	67.0	KIAA0654
AB033056	5e-16	31.5	KIAA1230

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001660 61 127 PF00536 Sterile alpha motif SAM

IPR001660 176 240 PF00536 Sterile alpha motif SAM

IPR011510 263 335 PF07647 Sterile alpha motif homology 2

HMMSmart IPR001660 60 129 SM00454 Sterile alpha motif SAM

IPR001660 175 242 SM00454 Sterile alpha motif SAM

IPR001660 263 335 SM00454 Sterile alpha motif SAM

ProfileScan IPR001660 63 129 PS50105 Sterile alpha motif SAM

IPR001660 185 242 PS50105 Sterile alpha motif SAM

IPR001660 266 335 PS50105 Sterile alpha motif SAM

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	61	127	PF00536	Sterile alpha motif SAM
IPR001660	176	240	PF00536	Sterile alpha motif SAM
IPR011510	263	335	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001660	60	129	SM00454	Sterile alpha motif SAM
IPR001660	175	242	SM00454	Sterile alpha motif SAM
IPR001660	263	335	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	63	129	PS50105	Sterile alpha motif SAM
IPR001660	185	242	PS50105	Sterile alpha motif SAM
IPR001660	266	335	PS50105	Sterile alpha motif SAM

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGGCTGTTGTCTTGGTGTATC

Primer_r
: ACTGAGAAGGGACCTGATGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGGCTGTTGTCTTGGTGTATC
Primer_r	: ACTGAGAAGGGACCTGATGAG
PCR product length	: 117 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2344 bp
Genome contig ID	gi89161185f_201192658
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- ACGTACCAATAAACAACCTGGTTTTAAGACAATGT
Flanking genome sequence (121830 - 121879)	----+--------+--------+--------+--------+----* ACAAATGGCCTCCAGTCTTTTTTTTTTTTTTTTTTTTTTTTTTTAACTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	201292658	201314486	12	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0897

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information