HUGE

Gene/Protein Characteristic Table for KIAA1230

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06448
Accession No. :	AB033056
Description :	Liprin-beta-1.
HUGO Gene Name :
Clone Name :	fh06860s1 [Vector Info]
Flexi ORF Clone :	pF1KA1230
Source :	Human fetal brain
Note :	We replaced fh06860, former representative clones for KIAA1230 with fh06860s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5720 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2682 bp

Genome contig ID gi89161190f_27468382
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TATGAAAGGAAATAAAGTCAATTGATAATTGCCTC
Flanking genome sequence
(271383 - 271432)
----+----*----+----*----+----*----+----*----+----*
ATTTTTATTGCCCTTATTTCATTTTCCGTTGTTCATAGTAACAGGCTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 27568382 27739763 27 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 932 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH50281	100.0	PPFIBP1 protein...	Homo sapiens
Q86W92	99.9	Liprin-beta-1; ...	Homo sapiens
EAW96558	100.0	PTPRF interacti...	Homo sapiens
XP_001363898	84.7	similar to PTPR...	Monodelphis dom...
BAG57559	99.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020704	1.5e-07	31.5	KIAA0897
AB014554	8.9e-07	24.7	KIAA0654

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001660 566 630 PF00536 Sterile alpha motif SAM

IPR001660 638 701 PF00536 Sterile alpha motif SAM

IPR011510 725 797 PF07647 Sterile alpha motif homology 2

HMMSmart IPR001660 565 632 SM00454 Sterile alpha motif SAM

IPR001660 637 703 SM00454 Sterile alpha motif SAM

IPR001660 725 797 SM00454 Sterile alpha motif SAM

ProfileScan IPR001660 568 632 PS50105 Sterile alpha motif SAM

IPR001660 640 703 PS50105 Sterile alpha motif SAM

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	566	630	PF00536	Sterile alpha motif SAM
IPR001660	638	701	PF00536	Sterile alpha motif SAM
IPR011510	725	797	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001660	565	632	SM00454	Sterile alpha motif SAM
IPR001660	637	703	SM00454	Sterile alpha motif SAM
IPR001660	725	797	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	568	632	PS50105	Sterile alpha motif SAM
IPR001660	640	703	PS50105	Sterile alpha motif SAM

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATCAAAAGGGCCATCCAGGTC

Primer_r
: TATTCTGCCAAGTCCACGGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATCAAAAGGGCCATCCAGGTC
Primer_r	: TATTCTGCCAAGTCCACGGAG
PCR product length	: 158(800) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2682 bp
Genome contig ID	gi89161190f_27468382
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TATGAAAGGAAATAAAGTCAATTGATAATTGCCTC
Flanking genome sequence (271383 - 271432)	----+--------+--------+--------+--------+----* ATTTTTATTGCCCTTATTTCATTTTCCGTTGTTCATAGTAACAGGCTTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	27568382	27739763	27	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1230

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information