| HUGE |
Gene/Protein Characteristic Table for KIAA0899 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00678 |
|---|---|
| Accession No. : | AB020706 |
| Description : | AP-2 complex subunit alpha-2. |
| HUGO Gene Name : | adaptor-related protein complex 2, alpha 2 subunit (AP2A2) |
| Clone Name : | hk09548s1 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0899
|
| Source : | Human adult brain |
| Note : | We replaced hk09548, former representative clones for KIAA0899 with hk09548s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4434 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1614 bp Genome contig ID gi51511727f_816022 PolyA signal sequence
(AATAAA,-18)
ACTCCTCGTCAAAGAAAAATAAAGGCTAGAACTGCFlanking genome sequence
(186219 - 186268)
ACCCCGGATCACGCGCTTTCTTTGGGGGGAAAGCATCCCATGTAACCCTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 f 916022 1002239 22 99.5 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 939 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : AATGTCTGCGGCTCTTCTTCC | |
| : TGAGAATGAGGGCCACACCAC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 11 |
| : GeneBridge 4 | |
| : AATGTCTGCGGCTCTTCTTCC | |
| : TGAGAATGAGGGCCACACCAC | |
| : 164 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
